Incidental Mutation 'R6836:AU018091'
ID534564
Institutional Source Beutler Lab
Gene Symbol AU018091
Ensembl Gene ENSMUSG00000054753
Gene Nameexpressed sequence AU018091
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6836 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3154658-3169203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3164156 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 77 (D77A)
Ref Sequence ENSEMBL: ENSMUSP00000144796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171749] [ENSMUST00000203937]
Predicted Effect probably damaging
Transcript: ENSMUST00000171749
AA Change: D86A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126800
Gene: ENSMUSG00000054753
AA Change: D86A

DomainStartEndE-ValueType
Pfam:AA_permease_2 82 504 2.9e-47 PFAM
Pfam:AA_permease 86 481 3.5e-31 PFAM
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 573 593 N/A INTRINSIC
Pfam:AA_permease_C 604 654 9.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203937
AA Change: D77A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144796
Gene: ENSMUSG00000054753
AA Change: D77A

DomainStartEndE-ValueType
Pfam:AA_permease_2 73 177 7.9e-11 PFAM
Pfam:AA_permease 77 176 3.1e-8 PFAM
Meta Mutation Damage Score 0.9038 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in AU018091
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:AU018091 APN 7 3158763 missense probably benign 0.01
IGL01063:AU018091 APN 7 3162313 missense possibly damaging 0.62
IGL01598:AU018091 APN 7 3162270 missense possibly damaging 0.71
IGL03253:AU018091 APN 7 3164172 missense probably damaging 1.00
IGL03386:AU018091 APN 7 3161267 missense probably damaging 1.00
IGL02835:AU018091 UTSW 7 3169071 missense unknown
R0070:AU018091 UTSW 7 3158898 splice site probably null
R0070:AU018091 UTSW 7 3158898 splice site probably null
R0733:AU018091 UTSW 7 3159161 missense probably damaging 1.00
R1221:AU018091 UTSW 7 3158877 missense probably damaging 1.00
R1467:AU018091 UTSW 7 3164259 missense probably benign 0.01
R1467:AU018091 UTSW 7 3164259 missense probably benign 0.01
R1708:AU018091 UTSW 7 3156344 missense probably damaging 1.00
R1990:AU018091 UTSW 7 3162264 missense probably benign 0.25
R4043:AU018091 UTSW 7 3159122 missense probably damaging 1.00
R4369:AU018091 UTSW 7 3157975 nonsense probably null
R4501:AU018091 UTSW 7 3159079 missense probably benign 0.25
R4595:AU018091 UTSW 7 3158428 missense possibly damaging 0.91
R4853:AU018091 UTSW 7 3156021 missense probably damaging 1.00
R6834:AU018091 UTSW 7 3157955 missense probably benign 0.06
R6941:AU018091 UTSW 7 3159427 critical splice donor site probably null
R7153:AU018091 UTSW 7 3159513 missense probably benign 0.01
R7196:AU018091 UTSW 7 3163958 missense probably damaging 1.00
R7237:AU018091 UTSW 7 3159166 missense probably benign 0.00
R7366:AU018091 UTSW 7 3156330 missense probably damaging 1.00
R7956:AU018091 UTSW 7 3161255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGTAGAGATATGCGGAACCC -3'
(R):5'- GCCCAAGTGCTTGAATTAAAGG -3'

Sequencing Primer
(F):5'- AACCCGAGCATGGTACCCTG -3'
(R):5'- ACCCTGTCAGGTGATTATTCAAG -3'
Posted On2018-09-12