Incidental Mutation 'R6836:Ptprh'
ID534565
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6836 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4551135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 778 (V778M)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000065957] [ENSMUST00000166650] [ENSMUST00000206023] [ENSMUST00000206933] [ENSMUST00000206999]
Predicted Effect probably damaging
Transcript: ENSMUST00000049113
AA Change: V778M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: V778M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065957
SMART Domains Protein: ENSMUSP00000070322
Gene: ENSMUSG00000004961

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
C2 124 226 2.8e-19 SMART
C2 255 369 4.76e-22 SMART
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166650
AA Change: V778M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: V778M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206023
Predicted Effect probably benign
Transcript: ENSMUST00000206933
Predicted Effect probably damaging
Transcript: ENSMUST00000206999
AA Change: V778M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2469 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
R7863:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
R7946:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
RF022:Ptprh UTSW 7 4549368 missense probably benign
Z1177:Ptprh UTSW 7 4597971 missense probably damaging 0.99
Z1177:Ptprh UTSW 7 4598118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCTCTGGGACACGCACTG -3'
(R):5'- AACATGCAAAAGGTATCTTGTTCTC -3'

Sequencing Primer
(F):5'- ACACGCACTGCAGGGAGAC -3'
(R):5'- CTGCCCCAGTGAGTATAGCATAG -3'
Posted On2018-09-12