Mutagenetix > Incidental Mutations

Incidental Mutation 'R6836:Lrrk1'

534566

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6836 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66342779 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 82 (E82K)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: E82K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: E82K

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,196,504	I81F	possibly damaging	Het
Adamtsl2	T	C	2: 27,081,706	M1T	probably null	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Alox8	T	C	11: 69,186,505	Y473C	probably damaging	Het
Alox8	T	C	11: 69,189,889	R209G	possibly damaging	Het
Asb5	A	G	8: 54,585,071	M210V	probably benign	Het
Atp2c2	T	A	8: 119,734,415	L249Q	probably damaging	Het
AU018091	T	G	7: 3,164,156	D77A	probably damaging	Het
Bahcc1	A	T	11: 120,271,757	K294*	probably null	Het
Baz2b	C	T	2: 59,917,425	R1298Q	probably damaging	Het
Bivm	T	A	1: 44,143,136	N501K	possibly damaging	Het
Bpifb5	T	A	2: 154,228,065	I145N	probably benign	Het
Casq2	A	T	3: 102,086,760	N41I	probably damaging	Het
Ccdc18	T	C	5: 108,197,967	L993P	probably damaging	Het
Cfap44	A	G	16: 44,404,079	D50G	probably damaging	Het
Clca3a2	T	A	3: 144,806,383	I91F	probably damaging	Het
Crebbp	T	A	16: 4,180,022	H66L	possibly damaging	Het
Cyfip2	T	C	11: 46,272,640	T321A	probably benign	Het
Dido1	A	G	2: 180,662,307	V1268A	probably benign	Het
E030030I06Rik	A	C	10: 22,148,492	V174G	probably damaging	Het
Gm20730	G	T	6: 43,081,833		probably null	Het
Gm36176	T	C	10: 77,847,142		probably benign	Het
Gper1	T	A	5: 139,426,680	M260K	probably damaging	Het
Igfbp2	T	C	1: 72,849,658	L89P	probably damaging	Het
Katnal1	T	C	5: 148,894,164	N200S	probably damaging	Het
Kcnk13	G	T	12: 100,061,689	R341L	probably damaging	Het
Klhl20	T	A	1: 161,105,406	E277D	probably benign	Het
Lingo1	T	C	9: 56,619,772	Y517C	probably damaging	Het
Mtor	T	A	4: 148,489,498	V1275D	possibly damaging	Het
Ncan	C	T	8: 70,100,315	S1089N	possibly damaging	Het
Notch4	C	T	17: 34,586,100	T1643I	probably damaging	Het
Olfr1258	T	C	2: 89,930,339	C177R	probably damaging	Het
Olfr1357	A	G	10: 78,612,590	L17P	probably damaging	Het
Olfr1387	A	T	11: 49,460,077	T133S	possibly damaging	Het
Olfr539	A	C	7: 140,668,180	I298L	possibly damaging	Het
Pcdhgb6	T	C	18: 37,742,962	V241A	probably benign	Het
Phf11b	T	A	14: 59,328,123	T102S	possibly damaging	Het
Pkd1	T	A	17: 24,581,259	V2998E	probably damaging	Het
Ppp1r13b	T	C	12: 111,835,195	S352G	probably benign	Het
Ptprh	C	T	7: 4,551,135	V778M	probably damaging	Het
Ptprz1	C	T	6: 23,030,665	Q1008*	probably null	Het
Ralgapa1	A	T	12: 55,604,273		probably null	Het
Rbm20	G	A	19: 53,814,069	G336E	probably damaging	Het
Sdsl	T	C	5: 120,462,102	I77V	probably benign	Het
Serpina3b	G	A	12: 104,134,082	E308K	probably benign	Het
Sfrp5	G	A	19: 42,201,710	T101I	probably damaging	Het
Slc2a13	C	T	15: 91,321,632	V451I	probably benign	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Spg11	C	T	2: 122,059,535	A2109T	probably damaging	Het
Stard9	C	T	2: 120,699,843	R2194C	probably benign	Het
Tfeb	T	C	17: 47,786,198		probably null	Het
Tiam2	T	A	17: 3,414,380	I128N	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tpr	T	G	1: 150,436,673		probably null	Het
Traf3ip1	T	C	1: 91,521,000	I456T	probably benign	Het
Ttll4	T	A	1: 74,689,413	D892E	probably damaging	Het
Ubr1	T	A	2: 120,896,675		probably null	Het
Vmn2r74	T	A	7: 85,957,422	I239F	probably benign	Het
Wdfy3	C	T	5: 101,952,999	V251M	probably damaging	Het
Xylb	T	A	9: 119,391,754	L531H	probably damaging	Het
Zfp960	T	A	17: 17,088,172	C383S	probably damaging	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TAGCTCAGTGGGTAAAAGCG -3'
(R):5'- TGTGTACATGTCCTCCCACG -3'

Sequencing Primer
(F):5'- TTCGGTACTACATGCCCATGGAAG -3'
(R):5'- CGCAGGTGCCGAAGACATG -3'

Posted On

2018-09-12