Incidental Mutation 'R6836:Atp2c2'
ID 534572
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6836 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120461154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 249 (L249Q)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]
AlphaFold A7L9Z8
Predicted Effect probably damaging
Transcript: ENSMUST00000095171
AA Change: L249Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: L249Q

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212454
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 26,971,718 (GRCm39) M1T probably null Het
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Alox8 T C 11: 69,077,331 (GRCm39) Y473C probably damaging Het
Alox8 T C 11: 69,080,715 (GRCm39) R209G possibly damaging Het
Asb5 A G 8: 55,038,106 (GRCm39) M210V probably benign Het
AU018091 T G 7: 3,213,986 (GRCm39) D77A probably damaging Het
Bahcc1 A T 11: 120,162,583 (GRCm39) K294* probably null Het
Baz2b C T 2: 59,747,769 (GRCm39) R1298Q probably damaging Het
Bivm T A 1: 44,182,296 (GRCm39) N501K possibly damaging Het
Bpifb5 T A 2: 154,069,985 (GRCm39) I145N probably benign Het
Casq2 A T 3: 101,994,076 (GRCm39) N41I probably damaging Het
Ccdc18 T C 5: 108,345,833 (GRCm39) L993P probably damaging Het
Cdcp3 A T 7: 130,798,233 (GRCm39) I81F possibly damaging Het
Cfap44 A G 16: 44,224,442 (GRCm39) D50G probably damaging Het
Clca3a2 T A 3: 144,512,144 (GRCm39) I91F probably damaging Het
Crebbp T A 16: 3,997,886 (GRCm39) H66L possibly damaging Het
Cyfip2 T C 11: 46,163,467 (GRCm39) T321A probably benign Het
Dido1 A G 2: 180,304,100 (GRCm39) V1268A probably benign Het
E030030I06Rik A C 10: 22,024,391 (GRCm39) V174G probably damaging Het
Gm20730 G T 6: 43,058,767 (GRCm39) probably null Het
Gm36176 T C 10: 77,682,976 (GRCm39) probably benign Het
Gper1 T A 5: 139,412,435 (GRCm39) M260K probably damaging Het
Igfbp2 T C 1: 72,888,817 (GRCm39) L89P probably damaging Het
Katnal1 T C 5: 148,830,974 (GRCm39) N200S probably damaging Het
Kcnk13 G T 12: 100,027,948 (GRCm39) R341L probably damaging Het
Klhl20 T A 1: 160,932,976 (GRCm39) E277D probably benign Het
Lingo1 T C 9: 56,527,056 (GRCm39) Y517C probably damaging Het
Lrrk1 C T 7: 65,992,527 (GRCm39) E82K probably benign Het
Mtor T A 4: 148,573,955 (GRCm39) V1275D possibly damaging Het
Ncan C T 8: 70,552,965 (GRCm39) S1089N possibly damaging Het
Notch4 C T 17: 34,805,074 (GRCm39) T1643I probably damaging Het
Or13a25 A C 7: 140,248,093 (GRCm39) I298L possibly damaging Het
Or1i2 A G 10: 78,448,424 (GRCm39) L17P probably damaging Het
Or2y15 A T 11: 49,350,904 (GRCm39) T133S possibly damaging Het
Or4c10 T C 2: 89,760,683 (GRCm39) C177R probably damaging Het
Pcdhgb6 T C 18: 37,876,015 (GRCm39) V241A probably benign Het
Phf11b T A 14: 59,565,572 (GRCm39) T102S possibly damaging Het
Pkd1 T A 17: 24,800,233 (GRCm39) V2998E probably damaging Het
Ppp1r13b T C 12: 111,801,629 (GRCm39) S352G probably benign Het
Ptprh C T 7: 4,554,134 (GRCm39) V778M probably damaging Het
Ptprz1 C T 6: 23,030,664 (GRCm39) Q1008* probably null Het
Ralgapa1 A T 12: 55,651,058 (GRCm39) probably null Het
Rbm20 G A 19: 53,802,500 (GRCm39) G336E probably damaging Het
Sdsl T C 5: 120,600,167 (GRCm39) I77V probably benign Het
Serpina3b G A 12: 104,100,341 (GRCm39) E308K probably benign Het
Sfrp5 G A 19: 42,190,149 (GRCm39) T101I probably damaging Het
Slc2a13 C T 15: 91,205,835 (GRCm39) V451I probably benign Het
Slc6a9 C T 4: 117,725,083 (GRCm39) A559V possibly damaging Het
Spg11 C T 2: 121,890,016 (GRCm39) A2109T probably damaging Het
Stard9 C T 2: 120,530,324 (GRCm39) R2194C probably benign Het
Tfeb T C 17: 48,097,123 (GRCm39) probably null Het
Tiam2 T A 17: 3,464,655 (GRCm39) I128N probably benign Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tpr T G 1: 150,312,424 (GRCm39) probably null Het
Traf3ip1 T C 1: 91,448,722 (GRCm39) I456T probably benign Het
Ttll4 T A 1: 74,728,572 (GRCm39) D892E probably damaging Het
Ubr1 T A 2: 120,727,156 (GRCm39) probably null Het
Vmn2r74 T A 7: 85,606,630 (GRCm39) I239F probably benign Het
Wdfy3 C T 5: 102,100,865 (GRCm39) V251M probably damaging Het
Xylb T A 9: 119,220,820 (GRCm39) L531H probably damaging Het
Zfp960 T A 17: 17,308,434 (GRCm39) C383S probably damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCCCCATGGCCTCTGTAG -3'
(R):5'- TTAGAACAAGTCTGGTGGAAGCTG -3'

Sequencing Primer
(F):5'- GCCTCTGTAGGGCAAGAGG -3'
(R):5'- AGCCCCTGCAGCTCTGAAG -3'
Posted On 2018-09-12