Incidental Mutation 'R6836:Alox8'
ID 534581
Institutional Source Beutler Lab
Gene Symbol Alox8
Ensembl Gene ENSMUSG00000020891
Gene Name arachidonate 8-lipoxygenase
Synonyms 8-LOX, 8S-lipoxygenase, 8S-LOX, Alox15b
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R6836 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69183932-69197843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69189889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 209 (R209G)
Ref Sequence ENSEMBL: ENSMUSP00000021262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021262] [ENSMUST00000094078]
AlphaFold O35936
Predicted Effect possibly damaging
Transcript: ENSMUST00000021262
AA Change: R209G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021262
Gene: ENSMUSG00000020891
AA Change: R209G

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 163 662 5.5e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094078
AA Change: R209G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000091621
Gene: ENSMUSG00000020891
AA Change: R209G

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 205 405 6.9e-44 PFAM
Pfam:Lipoxygenase 402 640 1.9e-60 PFAM
Meta Mutation Damage Score 0.0821 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene belongs to the lipoxygenase (LOX) gene family whose members encode enzymes that catalyze the addition of molecular oxygen to polyunsaturated fatty acids (PUFAs) to yield fatty acid hydroperoxides. The encoded enzyme preferentially metabolizes arachidonic acid to yield 8-hydroxyeicosatetraenoic acid (8-HETE), while metabolizing linoleic acid less efficiently. The gene may also function as a tumor suppressor. This gene is located in a cluster of related genes that spans approximately 75 kilobases on chromosome 11. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Alox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Alox8 APN 11 69188690 missense probably benign
IGL01878:Alox8 APN 11 69197038 missense probably benign 0.00
IGL02342:Alox8 APN 11 69186227 missense probably damaging 1.00
IGL02694:Alox8 APN 11 69186629 missense probably damaging 0.99
IGL03246:Alox8 APN 11 69186015 missense probably damaging 1.00
IGL03373:Alox8 APN 11 69186617 missense probably benign 0.00
R0567:Alox8 UTSW 11 69191522 critical splice donor site probably null
R1575:Alox8 UTSW 11 69185241 missense possibly damaging 0.94
R1688:Alox8 UTSW 11 69189906 missense probably benign 0.01
R2021:Alox8 UTSW 11 69186288 missense probably damaging 0.98
R2041:Alox8 UTSW 11 69197691 missense possibly damaging 0.67
R2175:Alox8 UTSW 11 69187766 missense possibly damaging 0.85
R2237:Alox8 UTSW 11 69185771 missense probably benign 0.00
R3821:Alox8 UTSW 11 69186482 missense probably damaging 0.98
R4870:Alox8 UTSW 11 69186568 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69186505 missense probably damaging 1.00
R7003:Alox8 UTSW 11 69191590 missense possibly damaging 0.70
R7158:Alox8 UTSW 11 69185870 missense probably benign 0.00
R7316:Alox8 UTSW 11 69186238 missense probably benign 0.01
R7513:Alox8 UTSW 11 69187844 missense probably benign 0.34
R9515:Alox8 UTSW 11 69185124 missense probably damaging 1.00
R9721:Alox8 UTSW 11 69197085 missense probably benign 0.19
X0065:Alox8 UTSW 11 69185253 missense probably damaging 1.00
Z1177:Alox8 UTSW 11 69185221 missense probably damaging 1.00
Z1186:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1186:Alox8 UTSW 11 69197496 missense probably benign
Z1187:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1187:Alox8 UTSW 11 69197496 missense probably benign
Z1188:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1188:Alox8 UTSW 11 69197496 missense probably benign
Z1189:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1189:Alox8 UTSW 11 69197496 missense probably benign
Z1190:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1190:Alox8 UTSW 11 69197496 missense probably benign
Z1191:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1191:Alox8 UTSW 11 69197496 missense probably benign
Z1192:Alox8 UTSW 11 69186047 missense probably benign 0.00
Z1192:Alox8 UTSW 11 69197496 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCTTTCGTGTCTATGGGAC -3'
(R):5'- ACTTACATGGTTCACTCAGCCC -3'

Sequencing Primer
(F):5'- GCATGGAGCCCAGCTAAAGTC -3'
(R):5'- TTCACTCAGCCCTGCCCAAG -3'
Posted On 2018-09-12