Incidental Mutation 'R6836:Serpina3b'
ID 534585
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms alpha-1 antiproteinase, 6A1, antitrypsin, A030003A19Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6836 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104094255-104105804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104100341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 308 (E308K)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
AlphaFold Q8BYY9
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: E308K

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: E308K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Meta Mutation Damage Score 0.1692 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 26,971,718 (GRCm39) M1T probably null Het
Aim2 C G 1: 173,291,546 (GRCm39) T317R probably damaging Het
Alox8 T C 11: 69,077,331 (GRCm39) Y473C probably damaging Het
Alox8 T C 11: 69,080,715 (GRCm39) R209G possibly damaging Het
Asb5 A G 8: 55,038,106 (GRCm39) M210V probably benign Het
Atp2c2 T A 8: 120,461,154 (GRCm39) L249Q probably damaging Het
AU018091 T G 7: 3,213,986 (GRCm39) D77A probably damaging Het
Bahcc1 A T 11: 120,162,583 (GRCm39) K294* probably null Het
Baz2b C T 2: 59,747,769 (GRCm39) R1298Q probably damaging Het
Bivm T A 1: 44,182,296 (GRCm39) N501K possibly damaging Het
Bpifb5 T A 2: 154,069,985 (GRCm39) I145N probably benign Het
Casq2 A T 3: 101,994,076 (GRCm39) N41I probably damaging Het
Ccdc18 T C 5: 108,345,833 (GRCm39) L993P probably damaging Het
Cdcp3 A T 7: 130,798,233 (GRCm39) I81F possibly damaging Het
Cfap44 A G 16: 44,224,442 (GRCm39) D50G probably damaging Het
Clca3a2 T A 3: 144,512,144 (GRCm39) I91F probably damaging Het
Crebbp T A 16: 3,997,886 (GRCm39) H66L possibly damaging Het
Cyfip2 T C 11: 46,163,467 (GRCm39) T321A probably benign Het
Dido1 A G 2: 180,304,100 (GRCm39) V1268A probably benign Het
E030030I06Rik A C 10: 22,024,391 (GRCm39) V174G probably damaging Het
Gm20730 G T 6: 43,058,767 (GRCm39) probably null Het
Gm36176 T C 10: 77,682,976 (GRCm39) probably benign Het
Gper1 T A 5: 139,412,435 (GRCm39) M260K probably damaging Het
Igfbp2 T C 1: 72,888,817 (GRCm39) L89P probably damaging Het
Katnal1 T C 5: 148,830,974 (GRCm39) N200S probably damaging Het
Kcnk13 G T 12: 100,027,948 (GRCm39) R341L probably damaging Het
Klhl20 T A 1: 160,932,976 (GRCm39) E277D probably benign Het
Lingo1 T C 9: 56,527,056 (GRCm39) Y517C probably damaging Het
Lrrk1 C T 7: 65,992,527 (GRCm39) E82K probably benign Het
Mtor T A 4: 148,573,955 (GRCm39) V1275D possibly damaging Het
Ncan C T 8: 70,552,965 (GRCm39) S1089N possibly damaging Het
Notch4 C T 17: 34,805,074 (GRCm39) T1643I probably damaging Het
Or13a25 A C 7: 140,248,093 (GRCm39) I298L possibly damaging Het
Or1i2 A G 10: 78,448,424 (GRCm39) L17P probably damaging Het
Or2y15 A T 11: 49,350,904 (GRCm39) T133S possibly damaging Het
Or4c10 T C 2: 89,760,683 (GRCm39) C177R probably damaging Het
Pcdhgb6 T C 18: 37,876,015 (GRCm39) V241A probably benign Het
Phf11b T A 14: 59,565,572 (GRCm39) T102S possibly damaging Het
Pkd1 T A 17: 24,800,233 (GRCm39) V2998E probably damaging Het
Ppp1r13b T C 12: 111,801,629 (GRCm39) S352G probably benign Het
Ptprh C T 7: 4,554,134 (GRCm39) V778M probably damaging Het
Ptprz1 C T 6: 23,030,664 (GRCm39) Q1008* probably null Het
Ralgapa1 A T 12: 55,651,058 (GRCm39) probably null Het
Rbm20 G A 19: 53,802,500 (GRCm39) G336E probably damaging Het
Sdsl T C 5: 120,600,167 (GRCm39) I77V probably benign Het
Sfrp5 G A 19: 42,190,149 (GRCm39) T101I probably damaging Het
Slc2a13 C T 15: 91,205,835 (GRCm39) V451I probably benign Het
Slc6a9 C T 4: 117,725,083 (GRCm39) A559V possibly damaging Het
Spg11 C T 2: 121,890,016 (GRCm39) A2109T probably damaging Het
Stard9 C T 2: 120,530,324 (GRCm39) R2194C probably benign Het
Tfeb T C 17: 48,097,123 (GRCm39) probably null Het
Tiam2 T A 17: 3,464,655 (GRCm39) I128N probably benign Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tpr T G 1: 150,312,424 (GRCm39) probably null Het
Traf3ip1 T C 1: 91,448,722 (GRCm39) I456T probably benign Het
Ttll4 T A 1: 74,728,572 (GRCm39) D892E probably damaging Het
Ubr1 T A 2: 120,727,156 (GRCm39) probably null Het
Vmn2r74 T A 7: 85,606,630 (GRCm39) I239F probably benign Het
Wdfy3 C T 5: 102,100,865 (GRCm39) V251M probably damaging Het
Xylb T A 9: 119,220,820 (GRCm39) L531H probably damaging Het
Zfp960 T A 17: 17,308,434 (GRCm39) C383S probably damaging Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104,105,046 (GRCm39) missense probably benign 0.03
IGL00427:Serpina3b APN 12 104,099,200 (GRCm39) missense probably benign 0.06
IGL01637:Serpina3b APN 12 104,099,216 (GRCm39) missense probably benign 0.00
IGL01738:Serpina3b APN 12 104,097,091 (GRCm39) missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104,096,721 (GRCm39) start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104,097,313 (GRCm39) missense probably benign 0.22
R0141:Serpina3b UTSW 12 104,097,030 (GRCm39) missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104,096,986 (GRCm39) missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104,096,929 (GRCm39) missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104,097,138 (GRCm39) missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104,104,969 (GRCm39) missense probably benign 0.02
R1802:Serpina3b UTSW 12 104,104,896 (GRCm39) missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104,105,069 (GRCm39) missense probably benign 0.01
R3871:Serpina3b UTSW 12 104,105,047 (GRCm39) missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104,096,889 (GRCm39) missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104,097,036 (GRCm39) missense probably benign 0.02
R5970:Serpina3b UTSW 12 104,100,350 (GRCm39) missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104,097,356 (GRCm39) missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104,100,428 (GRCm39) missense probably benign 0.00
R6673:Serpina3b UTSW 12 104,096,928 (GRCm39) missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104,099,251 (GRCm39) missense probably benign 0.00
R6893:Serpina3b UTSW 12 104,099,285 (GRCm39) missense probably benign 0.04
R7414:Serpina3b UTSW 12 104,099,145 (GRCm39) missense probably benign 0.03
R7539:Serpina3b UTSW 12 104,096,970 (GRCm39) missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104,096,722 (GRCm39) start codon destroyed probably null 1.00
R7817:Serpina3b UTSW 12 104,099,223 (GRCm39) missense probably benign 0.01
R8040:Serpina3b UTSW 12 104,097,335 (GRCm39) missense probably benign 0.00
R8143:Serpina3b UTSW 12 104,096,793 (GRCm39) missense probably benign 0.06
R8360:Serpina3b UTSW 12 104,104,962 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACCAAGTCAGTTTGCC -3'
(R):5'- GATTCAAAGTGAATGAGCCGTG -3'

Sequencing Primer
(F):5'- TGTCCACTGTAAACACTCTCAGG -3'
(R):5'- CAAAGTGAATGAGCCGTGTTCCTTG -3'
Posted On 2018-09-12