Incidental Mutation 'R6836:Phf11b'
ID534588
Institutional Source Beutler Lab
Gene Symbol Phf11b
Ensembl Gene ENSMUSG00000091649
Gene NamePHD finger protein 11B
SynonymsGm4902
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6836 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59320964-59341351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59328123 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 102 (T102S)
Ref Sequence ENSEMBL: ENSMUSP00000127857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166121
AA Change: T102S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127857
Gene: ENSMUSG00000091649
AA Change: T102S

DomainStartEndE-ValueType
PHD 92 143 1.55e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Phf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Phf11b APN 14 59324875 missense probably damaging 1.00
IGL01116:Phf11b APN 14 59323182 missense probably benign 0.02
IGL01446:Phf11b APN 14 59341291 missense probably benign 0.02
IGL02224:Phf11b APN 14 59326066 splice site probably benign
IGL03062:Phf11b APN 14 59324924 missense probably damaging 1.00
PIT4131001:Phf11b UTSW 14 59323162 splice site probably benign
R1795:Phf11b UTSW 14 59328105 missense probably benign 0.00
R3774:Phf11b UTSW 14 59326057 missense probably benign 0.45
R4553:Phf11b UTSW 14 59341285 missense probably benign 0.10
R5460:Phf11b UTSW 14 59331264 missense probably benign 0.01
R5620:Phf11b UTSW 14 59321504 missense probably benign 0.01
R5985:Phf11b UTSW 14 59321578 missense possibly damaging 0.52
R5990:Phf11b UTSW 14 59324926 missense possibly damaging 0.57
R6775:Phf11b UTSW 14 59338645 missense probably benign 0.14
R7197:Phf11b UTSW 14 59326058 missense probably benign 0.06
R8043:Phf11b UTSW 14 59331273 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TATGTCACAGGCTAGCCACC -3'
(R):5'- ATGCCAGGCCTTTGATTCTAATTG -3'

Sequencing Primer
(F):5'- GGCTAGCCACCCCCTAAG -3'
(R):5'- TGCTGAAACTTCCTCATGGG -3'
Posted On2018-09-12