Incidental Mutation 'R6843:Sqor'
ID534606
Institutional Source Beutler Lab
Gene Symbol Sqor
Ensembl Gene ENSMUSG00000005803
Gene Namesulfide quinone oxidoreductase
Synonyms0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location122765237-122809569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122784980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000117575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000124460] [ENSMUST00000126403] [ENSMUST00000147475]
Predicted Effect probably benign
Transcript: ENSMUST00000005953
AA Change: V7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803
AA Change: V7A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 44 189 1.7e-11 PFAM
SCOP:d1fcda1 240 364 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110506
AA Change: V7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803
AA Change: V7A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 342 7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124460
AA Change: V7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000126403
AA Change: V7A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803
AA Change: V7A

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 45 192 8.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147475
AA Change: V7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Sqor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Sqor APN 2 122787543 missense probably damaging 0.97
IGL01544:Sqor APN 2 122792346 splice site probably benign
IGL02499:Sqor APN 2 122808087 missense possibly damaging 0.93
IGL02583:Sqor APN 2 122799770 missense probably damaging 0.98
IGL02732:Sqor APN 2 122799762 missense possibly damaging 0.76
IGL03137:Sqor APN 2 122808071 missense probably benign
H8786:Sqor UTSW 2 122792368 missense probably benign 0.10
R0126:Sqor UTSW 2 122798027 unclassified probably benign
R0410:Sqor UTSW 2 122787522 missense probably benign
R0502:Sqor UTSW 2 122798050 missense probably benign 0.04
R0709:Sqor UTSW 2 122799855 missense probably benign 0.38
R1486:Sqor UTSW 2 122807645 splice site probably null
R2001:Sqor UTSW 2 122798098 missense probably damaging 0.98
R2020:Sqor UTSW 2 122804107 critical splice donor site probably null
R2039:Sqor UTSW 2 122792404 critical splice donor site probably null
R2404:Sqor UTSW 2 122808023 missense probably benign
R4213:Sqor UTSW 2 122787498 missense probably damaging 1.00
R4909:Sqor UTSW 2 122785181 missense possibly damaging 0.82
R5630:Sqor UTSW 2 122809357 missense possibly damaging 0.71
R5659:Sqor UTSW 2 122787603 missense probably benign 0.02
R5728:Sqor UTSW 2 122809400 makesense probably null
R5772:Sqor UTSW 2 122809341 missense probably benign 0.00
R6527:Sqor UTSW 2 122809286 missense probably damaging 0.98
R6657:Sqor UTSW 2 122807594 missense possibly damaging 0.68
R6843:Sqor UTSW 2 122809295 missense probably damaging 0.99
R7193:Sqor UTSW 2 122804009 missense probably damaging 1.00
R7320:Sqor UTSW 2 122799810 missense probably benign
R7417:Sqor UTSW 2 122787530 missense probably benign 0.35
R7846:Sqor UTSW 2 122785088 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GAAGCTAGCTTCCTGGAAGG -3'
(R):5'- GACACTTACCTCACTGGGTTC -3'

Sequencing Primer
(F):5'- TCCTGGAAGGAAGTCAGATTTTAGC -3'
(R):5'- TCACTGGGTTCAACAATGGC -3'
Posted On2018-09-12