Incidental Mutation 'R6843:Oprl1'
ID534608
Institutional Source Beutler Lab
Gene Symbol Oprl1
Ensembl Gene ENSMUSG00000027584
Gene Nameopioid receptor-like 1
SynonymsORL1, morc, N/OFQ receptor, MOR-C, nociceptin/ orphaninFQ receptor, LC132, XOR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181715016-181720985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181715754 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 11 (E11G)
Ref Sequence ENSEMBL: ENSMUSP00000139119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071585] [ENSMUST00000108763] [ENSMUST00000108766] [ENSMUST00000108767] [ENSMUST00000108768] [ENSMUST00000148334] [ENSMUST00000183693] [ENSMUST00000184127] [ENSMUST00000184795]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071585
AA Change: E11G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071513
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
Pfam:7tm_4 54 334 5.8e-9 PFAM
Pfam:7TM_GPCR_Srx 56 264 1.4e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 1.4e-62 PFAM
Pfam:7TM_GPCR_Srv 112 332 7.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108763
SMART Domains Protein: ENSMUSP00000104394
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 317 6.9e-11 PFAM
Pfam:7tm_1 60 302 1.6e-62 PFAM
Pfam:7TM_GPCR_Srv 91 318 4.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108766
AA Change: E11G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104397
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 189 3.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 59 201 1.8e-9 PFAM
Pfam:7tm_1 65 210 1.6e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108767
AA Change: E11G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104398
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108768
AA Change: E11G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104399
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148334
AA Change: E11G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118664
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
Pfam:7tm_1 65 140 5.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183693
AA Change: E11G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138810
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 77 1e-3 SMART
PDB:4EA3|B 41 76 9e-17 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000184127
AA Change: E11G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139119
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 76 3e-4 SMART
PDB:4EA3|B 41 76 1e-16 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000184795
AA Change: E11G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138979
Gene: ENSMUSG00000027584
AA Change: E11G

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 71 2e-3 SMART
PDB:4EA3|B 41 71 5e-13 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit altered touch/nociception, facilitation of long-term potentiation and memory, increased dopamine release upon administration of opioid peptide agonist, impaired behavioral response to morphine, and increased susceptibility to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Oprl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Oprl1 APN 2 181718511 missense probably damaging 1.00
R0302:Oprl1 UTSW 2 181719228 missense probably benign 0.01
R0453:Oprl1 UTSW 2 181718734 critical splice donor site probably null
R1564:Oprl1 UTSW 2 181718940 missense possibly damaging 0.79
R1618:Oprl1 UTSW 2 181718853 missense probably benign 0.22
R4801:Oprl1 UTSW 2 181719253 missense probably benign
R4802:Oprl1 UTSW 2 181719253 missense probably benign
R5032:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R5133:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R5134:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R6284:Oprl1 UTSW 2 181717991 intron probably benign
R6374:Oprl1 UTSW 2 181715928 missense probably damaging 1.00
R6394:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R7009:Oprl1 UTSW 2 181718381 missense probably damaging 1.00
R8329:Oprl1 UTSW 2 181718924 missense probably damaging 1.00
X0022:Oprl1 UTSW 2 181715807 missense probably benign 0.28
X0024:Oprl1 UTSW 2 181718548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGCCCATGTGTATGCC -3'
(R):5'- TACATGACGAGGCAGTTCCC -3'

Sequencing Primer
(F):5'- TCTGTGTGTGGATGCCCATC -3'
(R):5'- AGGCAGTTCCCCAGGAG -3'
Posted On2018-09-12