Mutagenetix > Incidental Mutations

Incidental Mutation 'R6843:Ash1l'

534611

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik

MMRRC Submission

Accession Numbers

Genbank: NM_138679; MGI: 2183158

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6843 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88950622-89079375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88985388 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1525 (Y1525N)

Ref Sequence

ENSEMBL: ENSMUSP00000140251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090933
AA Change: Y1525N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: Y1525N

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186583
AA Change: Y1525N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: Y1525N

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,638,401	Q78L	probably benign	Het
Akr1c21	A	G	13: 4,575,214	H48R	probably damaging	Het
Anks1b	T	A	10: 90,948,598	S1143T	probably damaging	Het
Apip	T	G	2: 103,092,489	F217L	probably benign	Het
Bcl2l13	G	A	6: 120,848,617		probably null	Het
Cep85	C	G	4: 134,155,856	A241P	probably benign	Het
Clk4	T	G	11: 51,276,249		probably null	Het
Cnr2	C	T	4: 135,917,589	P326L	probably benign	Het
Cryaa	A	G	17: 31,678,173	D58G	possibly damaging	Het
Crybg3	G	A	16: 59,559,796	T365M	probably benign	Het
Csmd2	A	G	4: 128,463,794	N1683D	probably benign	Het
Dbx2	T	G	15: 95,654,459	I102L	possibly damaging	Het
Dll4	A	T	2: 119,325,994		probably benign	Het
Epb42	T	A	2: 121,027,685	Y264F	possibly damaging	Het
Exoc3l	T	A	8: 105,290,097	H695L	probably benign	Het
Fam160a1	G	A	3: 85,673,045	P618S	probably damaging	Het
Ghsr	A	C	3: 27,372,527	D244A	probably benign	Het
Gm9195	A	G	14: 72,441,211	Y2268H	possibly damaging	Het
Hdac1	A	G	4: 129,542,590	Y14H	probably damaging	Het
Hdac3	A	T	18: 37,941,954	Y282N	probably benign	Het
Heg1	T	A	16: 33,719,526	N285K	probably benign	Het
Igkv4-90	A	G	6: 68,807,686	F8S	possibly damaging	Het
Map2k1	A	T	9: 64,187,691	D336E	probably damaging	Het
Map4k2	A	T	19: 6,353,447	I796F	probably damaging	Het
Mapk13	T	A	17: 28,775,453		probably null	Het
Mprip	A	G	11: 59,759,728	I1419M	possibly damaging	Het
Nrap	T	C	19: 56,380,219	E255G	probably damaging	Het
Olfr1306	T	C	2: 111,912,915	N5S	probably damaging	Het
Olfr1357	T	C	10: 78,612,057	N195D	probably damaging	Het
Olfr1451	G	T	19: 12,998,998	C4F	probably benign	Het
Olfr549	A	G	7: 102,554,721	I146V	probably benign	Het
Olfr799	A	G	10: 129,647,179	D17G	possibly damaging	Het
Oprl1	A	G	2: 181,715,754	E11G	probably damaging	Het
Palmd	T	A	3: 116,924,215	D211V	probably damaging	Het
Pcdhga11	A	G	18: 37,756,325	N129D	probably damaging	Het
Plekha6	T	A	1: 133,274,878	M359K	probably damaging	Het
Plekha7	G	T	7: 116,143,320	H756Q	probably benign	Het
Ppfibp2	C	T	7: 107,727,731	P441S	probably benign	Het
Ptprk	T	C	10: 28,591,982	I1373T	possibly damaging	Het
Serpinb9g	G	T	13: 33,492,917	L227F	probably damaging	Het
Snapc4	C	A	2: 26,373,599	A11S	probably benign	Het
Sqor	T	C	2: 122,784,980	V7A	probably benign	Het
Sqor	G	T	2: 122,809,295	G437V	probably damaging	Het
Srrm3	T	C	5: 135,852,281	V145A	probably benign	Het
Stx1b	G	A	7: 127,814,979	Q72*	probably null	Het
Syt7	A	G	19: 10,421,771	D77G	probably damaging	Het
Tvp23a	G	A	16: 10,447,020	A9V	probably benign	Het
Vmn1r66	T	A	7: 10,274,765	I114F	probably damaging	Het
Vmn2r80	C	A	10: 79,169,668	Q380K	probably benign	Het
Xdh	C	T	17: 73,923,130	E269K	probably damaging	Het
Zfp932	T	C	5: 110,008,715	M92T	probably benign	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88981712	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	89007736	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	89035236	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	89072484	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88984635	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	89063902	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88983529	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	89066265	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88985506	nonsense	probably null
IGL02326:Ash1l	APN	3	88966057	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	89072548	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88985565	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	89069079	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	89066218	nonsense	probably null
IGL02727:Ash1l	APN	3	89023037	missense	probably benign
IGL02732:Ash1l	APN	3	88966228	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88984801	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88984181	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	89035268	splice site	probably benign
IGL03253:Ash1l	APN	3	88984674	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	89023083	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	89007220	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88966326	missense	probably benign
BB008:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	89058589	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88983459	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88982277	missense	probably benign
R0543:Ash1l	UTSW	3	89063778	splice site	probably null
R0855:Ash1l	UTSW	3	89054454	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	89035263	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88983316	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88984897	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	89007352	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88985052	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	89058499	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	89072476	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	89067242	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	89076224	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88965984	missense	probably benign
R1793:Ash1l	UTSW	3	89070309	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88981555	missense	probably benign	0.00
R1909:Ash1l	UTSW	3	88984528	missense	probably benign	0.29
R1938:Ash1l	UTSW	3	88984422	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	89066317	missense	probably benign	0.00
R2070:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2071:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88985295	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	89066298	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	89007367	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	89026426	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	89054386	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88982260	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88981966	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	89066415	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	89007199	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88985315	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	89072476	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88982845	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88985334	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	89058634	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88982323	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	89023212	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	89052877	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	89066275	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88982394	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88984876	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88981426	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	89023185	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88985609	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	89007607	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	89051990	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	89054498	missense	possibly damaging	0.83
R5719:Ash1l	UTSW	3	89058626	missense	probably damaging	1.00
R5839:Ash1l	UTSW	3	88983351	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	89068993	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88981584	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88984036	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	89053143	nonsense	probably null
R6110:Ash1l	UTSW	3	88985129	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	89052773	nonsense	probably null
R6200:Ash1l	UTSW	3	89070527	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88982761	nonsense	probably null
R6331:Ash1l	UTSW	3	89007865	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88983780	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88985061	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	89052037	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	89076113	missense	probably benign	0.00
R6894:Ash1l	UTSW	3	88982991	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88981657	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88982671	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88985340	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88983457	frame shift	probably null
R7150:Ash1l	UTSW	3	89077074	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	89070509	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	89054634	splice site	probably null
R7288:Ash1l	UTSW	3	88965892	start gained	probably benign
R7319:Ash1l	UTSW	3	88981387	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88981759	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88965997	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88983865	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	89043193	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	89007264	missense	probably benign
R7857:Ash1l	UTSW	3	88984309	nonsense	probably null
R7889:Ash1l	UTSW	3	88966038	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88983625	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	89070317	nonsense	probably null
R7973:Ash1l	UTSW	3	89052857	missense	probably benign
R8119:Ash1l	UTSW	3	89035427	missense	probably damaging	1.00
R8157:Ash1l	UTSW	3	89063707	critical splice donor site	probably null
R8162:Ash1l	UTSW	3	89070246	missense	probably damaging	0.99
R8194:Ash1l	UTSW	3	89052755	missense	probably damaging	1.00
R8306:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	89007644	missense	probably benign	0.02
X0017:Ash1l	UTSW	3	88984585	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	89070556	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88983204	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88982709	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	89043217	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTTCTTACAACCAGCAGG -3'
(R):5'- TGGGAGAACTTTCTGAGCAGTC -3'

Sequencing Primer
(F):5'- TTTCCATGAGCACCTACCCCAG -3'
(R):5'- GGAGAACTTTCTGAGCAGTCAATTTG -3'

Posted On

2018-09-12