Incidental Mutation 'R6843:Cep85'
ID534615
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Namecentrosomal protein 85
Synonyms2410030J07Rik, Ccdc21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location134129858-134187112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 134155856 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 241 (A241P)
Ref Sequence ENSEMBL: ENSMUSP00000113351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040271] [ENSMUST00000121566] [ENSMUST00000137388]
Predicted Effect probably benign
Transcript: ENSMUST00000040271
AA Change: A241P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: A241P

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121566
AA Change: A241P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: A241P

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137388
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 134148761 missense possibly damaging 0.63
IGL01397:Cep85 APN 4 134156206 missense probably damaging 1.00
IGL01472:Cep85 APN 4 134134166 missense possibly damaging 0.55
IGL01522:Cep85 APN 4 134152255 missense probably damaging 1.00
IGL01522:Cep85 APN 4 134152256 missense probably damaging 1.00
IGL02004:Cep85 APN 4 134167387 missense probably damaging 1.00
IGL02043:Cep85 APN 4 134155727 missense probably benign 0.02
IGL02187:Cep85 APN 4 134131305 missense possibly damaging 0.86
IGL02317:Cep85 APN 4 134155811 missense probably damaging 1.00
IGL02543:Cep85 APN 4 134156323 missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 134156264 missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 134148697 missense probably damaging 1.00
R0060:Cep85 UTSW 4 134167300 missense probably damaging 1.00
R0068:Cep85 UTSW 4 134154295 missense probably benign 0.00
R0346:Cep85 UTSW 4 134132422 missense probably damaging 1.00
R0462:Cep85 UTSW 4 134131421 missense possibly damaging 0.88
R1295:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1296:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1472:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1577:Cep85 UTSW 4 134152288 missense probably damaging 1.00
R1681:Cep85 UTSW 4 134148728 nonsense probably null
R1687:Cep85 UTSW 4 134148013 missense probably benign 0.00
R2031:Cep85 UTSW 4 134132450 missense probably benign 0.00
R2216:Cep85 UTSW 4 134131430 missense possibly damaging 0.62
R2220:Cep85 UTSW 4 134153867 missense probably damaging 1.00
R4321:Cep85 UTSW 4 134132285 missense probably damaging 1.00
R4888:Cep85 UTSW 4 134164751 intron probably benign
R5044:Cep85 UTSW 4 134156179 missense probably damaging 0.97
R5075:Cep85 UTSW 4 134132367 missense probably damaging 1.00
R5627:Cep85 UTSW 4 134134097 missense probably damaging 1.00
R6841:Cep85 UTSW 4 134155856 missense probably benign
R6842:Cep85 UTSW 4 134155856 missense probably benign
R6981:Cep85 UTSW 4 134152261 missense probably damaging 1.00
R7252:Cep85 UTSW 4 134148031 missense probably benign 0.12
R7869:Cep85 UTSW 4 134132298 missense probably damaging 0.99
R8057:Cep85 UTSW 4 134153614 unclassified probably benign
R8194:Cep85 UTSW 4 134134089 missense probably null 0.00
V8831:Cep85 UTSW 4 134156069 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCAAGGAGGAACACAACATGC -3'
(R):5'- ATGGAGTCTACCCTTAACCAGCC -3'

Sequencing Primer
(F):5'- AGAACTAGTTCTCTACCTGCATTTG -3'
(R):5'- CAGCCATGCTAGAGACGTTATACTC -3'
Posted On2018-09-12