Incidental Mutation 'R6843:Zfp932'
ID534617
Institutional Source Beutler Lab
Gene Symbol Zfp932
Ensembl Gene ENSMUSG00000066613
Gene Namezinc finger protein 932
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109996521-110010411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110008715 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 92 (M92T)
Ref Sequence ENSEMBL: ENSMUSP00000121749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099484] [ENSMUST00000112536] [ENSMUST00000112540] [ENSMUST00000125213] [ENSMUST00000143639] [ENSMUST00000187241]
Predicted Effect probably benign
Transcript: ENSMUST00000099484
SMART Domains Protein: ENSMUSP00000097083
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112536
AA Change: M60T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108155
Gene: ENSMUSG00000066613
AA Change: M60T

DomainStartEndE-ValueType
Blast:KRAB 1 31 5e-12 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
ZnF_C2H2 183 205 1.3e-4 SMART
ZnF_C2H2 211 233 1.1e-2 SMART
ZnF_C2H2 239 261 2.27e-4 SMART
ZnF_C2H2 267 289 1.84e-4 SMART
ZnF_C2H2 295 317 5.21e-4 SMART
ZnF_C2H2 323 345 9.73e-4 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 1.58e-3 SMART
ZnF_C2H2 407 429 5.14e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
ZnF_C2H2 463 485 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112540
AA Change: M93T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108159
Gene: ENSMUSG00000066613
AA Change: M93T

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
ZnF_C2H2 104 126 1.1e-2 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 3.39e-3 SMART
ZnF_C2H2 188 210 1.76e-1 SMART
ZnF_C2H2 216 238 1.3e-4 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.27e-4 SMART
ZnF_C2H2 300 322 1.84e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 9.73e-4 SMART
ZnF_C2H2 384 406 1.58e-3 SMART
ZnF_C2H2 412 434 1.58e-3 SMART
ZnF_C2H2 440 462 5.14e-3 SMART
ZnF_C2H2 468 490 2.61e-4 SMART
ZnF_C2H2 496 518 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125213
AA Change: M60T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119843
Gene: ENSMUSG00000066613
AA Change: M60T

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-14 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
Pfam:zf-C2H2_6 182 191 7.3e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143639
AA Change: M92T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121749
Gene: ENSMUSG00000066613
AA Change: M92T

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 5.21e-4 SMART
ZnF_C2H2 159 181 3.39e-3 SMART
ZnF_C2H2 187 209 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187241
AA Change: M93T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140446
Gene: ENSMUSG00000066613
AA Change: M93T

DomainStartEndE-ValueType
KRAB 5 61 7.1e-17 SMART
ZnF_C2H2 104 126 4.8e-5 SMART
ZnF_C2H2 132 154 2.2e-6 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 7.2e-4 SMART
ZnF_C2H2 216 238 5.4e-7 SMART
ZnF_C2H2 244 266 4.5e-5 SMART
ZnF_C2H2 272 294 9.2e-7 SMART
ZnF_C2H2 300 322 7.5e-7 SMART
ZnF_C2H2 328 350 2.1e-6 SMART
ZnF_C2H2 356 378 4e-6 SMART
ZnF_C2H2 384 406 6.5e-6 SMART
ZnF_C2H2 412 434 6.9e-6 SMART
ZnF_C2H2 440 462 2.1e-5 SMART
ZnF_C2H2 468 490 1.1e-6 SMART
ZnF_C2H2 496 518 1.1e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Other mutations in Zfp932
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Zfp932 UTSW 5 110006968 missense probably benign 0.27
R0268:Zfp932 UTSW 5 110009063 missense probably benign 0.24
R1673:Zfp932 UTSW 5 110008988 missense probably damaging 1.00
R1797:Zfp932 UTSW 5 109996623 start gained probably benign
R1893:Zfp932 UTSW 5 110009203 missense possibly damaging 0.71
R1942:Zfp932 UTSW 5 110006987 missense probably damaging 1.00
R2073:Zfp932 UTSW 5 110009818 missense possibly damaging 0.60
R2076:Zfp932 UTSW 5 110009468 missense probably benign 0.01
R2329:Zfp932 UTSW 5 110009540 missense probably benign 0.01
R3944:Zfp932 UTSW 5 110009954 missense probably benign 0.37
R4551:Zfp932 UTSW 5 110009639 missense probably benign 0.03
R4679:Zfp932 UTSW 5 110009894 missense probably damaging 1.00
R4692:Zfp932 UTSW 5 110009186 missense probably damaging 1.00
R5116:Zfp932 UTSW 5 110009376 missense probably benign 0.05
R5260:Zfp932 UTSW 5 110009635 nonsense probably null
R5536:Zfp932 UTSW 5 110009847 nonsense probably null
R6351:Zfp932 UTSW 5 110009343 nonsense probably null
R6786:Zfp932 UTSW 5 110009740 missense probably damaging 0.98
R7437:Zfp932 UTSW 5 110010014 missense probably benign 0.10
R7496:Zfp932 UTSW 5 110008828 missense probably damaging 0.97
R7704:Zfp932 UTSW 5 110009764 missense probably benign 0.09
R8224:Zfp932 UTSW 5 109996614 start gained probably benign
R8317:Zfp932 UTSW 5 110009056 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCATTACAGGTATGCAAGGG -3'
(R):5'- GACAATGATGTGCAAAGGCTTTAC -3'

Sequencing Primer
(F):5'- GATGTGACTCCTCTTTACAATTAGGC -3'
(R):5'- TGGAATGCAAAGGCTTTACCAC -3'
Posted On2018-09-12