Mutagenetix > Incidental Mutations

Incidental Mutation 'R6843:Ptprk'

534629

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6843 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 28591982 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1373 (I1373T)

Ref Sequence

ENSEMBL: ENSMUSP00000126279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]

AlphaFold

P35822

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166468
AA Change: I1373T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I1373T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218276
AA Change: I1387T

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218359
AA Change: I1361T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000220357

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,638,401	Q78L	probably benign	Het
Akr1c21	A	G	13: 4,575,214	H48R	probably damaging	Het
Anks1b	T	A	10: 90,948,598	S1143T	probably damaging	Het
Apip	T	G	2: 103,092,489	F217L	probably benign	Het
Ash1l	T	A	3: 88,985,388	Y1525N	probably damaging	Het
Bcl2l13	G	A	6: 120,848,617		probably null	Het
Cep85	C	G	4: 134,155,856	A241P	probably benign	Het
Clk4	T	G	11: 51,276,249		probably null	Het
Cnr2	C	T	4: 135,917,589	P326L	probably benign	Het
Cryaa	A	G	17: 31,678,173	D58G	possibly damaging	Het
Crybg3	G	A	16: 59,559,796	T365M	probably benign	Het
Csmd2	A	G	4: 128,463,794	N1683D	probably benign	Het
Dbx2	T	G	15: 95,654,459	I102L	possibly damaging	Het
Dll4	A	T	2: 119,325,994		probably benign	Het
Epb42	T	A	2: 121,027,685	Y264F	possibly damaging	Het
Exoc3l	T	A	8: 105,290,097	H695L	probably benign	Het
Fam160a1	G	A	3: 85,673,045	P618S	probably damaging	Het
Ghsr	A	C	3: 27,372,527	D244A	probably benign	Het
Gm9195	A	G	14: 72,441,211	Y2268H	possibly damaging	Het
Hdac1	A	G	4: 129,542,590	Y14H	probably damaging	Het
Hdac3	A	T	18: 37,941,954	Y282N	probably benign	Het
Heg1	T	A	16: 33,719,526	N285K	probably benign	Het
Igkv4-90	A	G	6: 68,807,686	F8S	possibly damaging	Het
Map2k1	A	T	9: 64,187,691	D336E	probably damaging	Het
Map4k2	A	T	19: 6,353,447	I796F	probably damaging	Het
Mapk13	T	A	17: 28,775,453		probably null	Het
Mprip	A	G	11: 59,759,728	I1419M	possibly damaging	Het
Nrap	T	C	19: 56,380,219	E255G	probably damaging	Het
Olfr1306	T	C	2: 111,912,915	N5S	probably damaging	Het
Olfr1357	T	C	10: 78,612,057	N195D	probably damaging	Het
Olfr1451	G	T	19: 12,998,998	C4F	probably benign	Het
Olfr549	A	G	7: 102,554,721	I146V	probably benign	Het
Olfr799	A	G	10: 129,647,179	D17G	possibly damaging	Het
Oprl1	A	G	2: 181,715,754	E11G	probably damaging	Het
Palmd	T	A	3: 116,924,215	D211V	probably damaging	Het
Pcdhga11	A	G	18: 37,756,325	N129D	probably damaging	Het
Plekha6	T	A	1: 133,274,878	M359K	probably damaging	Het
Plekha7	G	T	7: 116,143,320	H756Q	probably benign	Het
Ppfibp2	C	T	7: 107,727,731	P441S	probably benign	Het
Serpinb9g	G	T	13: 33,492,917	L227F	probably damaging	Het
Snapc4	C	A	2: 26,373,599	A11S	probably benign	Het
Sqor	T	C	2: 122,784,980	V7A	probably benign	Het
Sqor	G	T	2: 122,809,295	G437V	probably damaging	Het
Srrm3	T	C	5: 135,852,281	V145A	probably benign	Het
Stx1b	G	A	7: 127,814,979	Q72*	probably null	Het
Syt7	A	G	19: 10,421,771	D77G	probably damaging	Het
Tvp23a	G	A	16: 10,447,020	A9V	probably benign	Het
Vmn1r66	T	A	7: 10,274,765	I114F	probably damaging	Het
Vmn2r80	C	A	10: 79,169,668	Q380K	probably benign	Het
Xdh	C	T	17: 73,923,130	E269K	probably damaging	Het
Zfp932	T	C	5: 110,008,715	M92T	probably benign	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTCTGAAAAGGCACCACAATTAC -3'
(R):5'- CTGCCAGGATTTGAGGAACATC -3'

Sequencing Primer
(F):5'- TAGACTCAGTCCAGTATAAGTTCCC -3'
(R):5'- TGAGGAACATCTTTTAAACACACAC -3'

Posted On

2018-09-12