Incidental Mutation 'R6843:Anks1b'
ID534632
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90948598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1143 (S1143T)
Ref Sequence ENSEMBL: ENSMUSP00000138539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099364] [ENSMUST00000099366] [ENSMUST00000179337] [ENSMUST00000179694] [ENSMUST00000182053] [ENSMUST00000182113] [ENSMUST00000182284] [ENSMUST00000182356] [ENSMUST00000182430] [ENSMUST00000182550] [ENSMUST00000182595] [ENSMUST00000182600] [ENSMUST00000183156] [ENSMUST00000182786] [ENSMUST00000182907] [ENSMUST00000182960] [ENSMUST00000182966] [ENSMUST00000183136]
Predicted Effect probably benign
Transcript: ENSMUST00000099364
AA Change: S370T

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096965
Gene: ENSMUSG00000058589
AA Change: S370T

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 131 269 1.5e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099366
AA Change: S150T

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096967
Gene: ENSMUSG00000058589
AA Change: S150T

DomainStartEndE-ValueType
PTB 63 201 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179337
AA Change: S150T

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136410
Gene: ENSMUSG00000058589
AA Change: S150T

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 156 294 1.6e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179694
AA Change: S150T

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136146
Gene: ENSMUSG00000058589
AA Change: S150T

DomainStartEndE-ValueType
PTB 96 234 1.5e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182053
AA Change: S279T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138644
Gene: ENSMUSG00000058589
AA Change: S279T

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
PTB 192 330 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182113
AA Change: S394T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138655
Gene: ENSMUSG00000058589
AA Change: S394T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182284
AA Change: S335T

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138794
Gene: ENSMUSG00000058589
AA Change: S335T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 248 386 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182356
AA Change: S313T

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138234
Gene: ENSMUSG00000058589
AA Change: S313T

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
low complexity region 138 153 N/A INTRINSIC
PTB 226 364 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182430
AA Change: S310T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138660
Gene: ENSMUSG00000058589
AA Change: S310T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 223 361 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182550
AA Change: S395T

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138643
Gene: ENSMUSG00000058589
AA Change: S395T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 308 446 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182595
AA Change: S370T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138314
Gene: ENSMUSG00000058589
AA Change: S370T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 283 421 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182600
AA Change: S303T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138650
Gene: ENSMUSG00000058589
AA Change: S303T

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
PTB 216 354 2.94e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183156
AA Change: S1143T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: S1143T

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182786
AA Change: S242T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138720
Gene: ENSMUSG00000058589
AA Change: S242T

DomainStartEndE-ValueType
Pfam:SAM_2 1 42 8.4e-8 PFAM
Pfam:SAM_1 2 43 5.4e-7 PFAM
Pfam:SAM_1 51 97 4.4e-10 PFAM
Pfam:SAM_2 52 95 6.1e-7 PFAM
PTB 155 293 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182960
AA Change: S334T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138222
Gene: ENSMUSG00000058589
AA Change: S334T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 247 385 2.94e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182966
AA Change: S175T

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138610
Gene: ENSMUSG00000058589
AA Change: S175T

DomainStartEndE-ValueType
PTB 88 226 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183024
Predicted Effect possibly damaging
Transcript: ENSMUST00000183136
AA Change: S394T

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138738
Gene: ENSMUSG00000058589
AA Change: S394T

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
R7325:Anks1b UTSW 10 90941432 missense probably damaging 1.00
R7392:Anks1b UTSW 10 90680786 missense possibly damaging 0.47
R7578:Anks1b UTSW 10 90049927 missense probably damaging 1.00
R7604:Anks1b UTSW 10 90260846 splice site probably null
R7633:Anks1b UTSW 10 90948584 missense probably damaging 1.00
R7881:Anks1b UTSW 10 90967018 missense probably benign 0.07
R7910:Anks1b UTSW 10 90680792 missense probably damaging 1.00
R7941:Anks1b UTSW 10 90577155 missense probably damaging 0.98
R8045:Anks1b UTSW 10 90680860 missense probably benign
R8146:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R8176:Anks1b UTSW 10 90069491 missense probably damaging 1.00
RF004:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF008:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF017:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF018:Anks1b UTSW 10 90033225 missense probably damaging 1.00
RF023:Anks1b UTSW 10 90033225 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGCAGCTCATTGAGTC -3'
(R):5'- TCATCATGGCAGACTGAGCAAAG -3'

Sequencing Primer
(F):5'- CAGCTCATTGAGTCACTTTGGACTAG -3'
(R):5'- TGGCAGACTGAGCAAAGTGATCTATC -3'
Posted On2018-09-12