Incidental Mutation 'R6843:Clk4'
ID534634
Institutional Source Beutler Lab
Gene Symbol Clk4
Ensembl Gene ENSMUSG00000020385
Gene NameCDC like kinase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location51261730-51281766 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 51276249 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093132] [ENSMUST00000109111] [ENSMUST00000109113] [ENSMUST00000126131] [ENSMUST00000130641] [ENSMUST00000148053] [ENSMUST00000153414]
Predicted Effect probably null
Transcript: ENSMUST00000093132
SMART Domains Protein: ENSMUSP00000090820
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
S_TKc 159 475 1.58e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109111
SMART Domains Protein: ENSMUSP00000104739
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109113
SMART Domains Protein: ENSMUSP00000104741
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126131
SMART Domains Protein: ENSMUSP00000118972
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130641
SMART Domains Protein: ENSMUSP00000123133
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
PDB:2VAG|A 149 182 2e-14 PDB
SCOP:d1howa_ 149 182 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148053
SMART Domains Protein: ENSMUSP00000120822
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153414
SMART Domains Protein: ENSMUSP00000115894
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Clk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Clk4 APN 11 51281172 nonsense probably null
B6819:Clk4 UTSW 11 51275766 unclassified probably benign
K7894:Clk4 UTSW 11 51275766 unclassified probably benign
R0001:Clk4 UTSW 11 51268765 splice site probably benign
R0466:Clk4 UTSW 11 51267328 missense possibly damaging 0.59
R0692:Clk4 UTSW 11 51281328 nonsense probably null
R0719:Clk4 UTSW 11 51275493 nonsense probably null
R0723:Clk4 UTSW 11 51275493 nonsense probably null
R1277:Clk4 UTSW 11 51267189 missense probably benign
R1714:Clk4 UTSW 11 51280418 missense probably damaging 1.00
R4804:Clk4 UTSW 11 51281323 missense probably damaging 1.00
R5141:Clk4 UTSW 11 51275771 missense possibly damaging 0.79
R5399:Clk4 UTSW 11 51275257 missense probably damaging 1.00
R6182:Clk4 UTSW 11 51268182 missense possibly damaging 0.66
R6274:Clk4 UTSW 11 51271921 missense possibly damaging 0.69
R6480:Clk4 UTSW 11 51270546 nonsense probably null
R6759:Clk4 UTSW 11 51275574 missense possibly damaging 0.95
R7138:Clk4 UTSW 11 51277932 missense probably damaging 1.00
R7186:Clk4 UTSW 11 51268780 missense probably benign 0.00
R7235:Clk4 UTSW 11 51276185 missense probably damaging 0.98
R7687:Clk4 UTSW 11 51281398 missense probably benign 0.02
R7842:Clk4 UTSW 11 51281129 missense probably benign 0.00
R8073:Clk4 UTSW 11 51277889 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGAGGGTTCATTTGCAAGCC -3'
(R):5'- GAGACTATGATACTCTCACCAAGC -3'

Sequencing Primer
(F):5'- GCAAGCCTTTTGAGTAGTGC -3'
(R):5'- GCACACCCACCATGTTATAATCAG -3'
Posted On2018-09-12