Incidental Mutation 'R6843:Serpinb9g'
ID534637
Institutional Source Beutler Lab
Gene Symbol Serpinb9g
Ensembl Gene ENSMUSG00000057726
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms1600002F03Rik, NK21B, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location33484790-33496004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33492917 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 227 (L227F)
Ref Sequence ENSEMBL: ENSMUSP00000080597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081927]
Predicted Effect probably damaging
Transcript: ENSMUST00000081927
AA Change: L227F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080597
Gene: ENSMUSG00000057726
AA Change: L227F

DomainStartEndE-ValueType
SERPIN 13 377 2.87e-166 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mapk13 T A 17: 28,775,453 probably null Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Serpinb9g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Serpinb9g APN 13 33495105 nonsense probably null
IGL02346:Serpinb9g APN 13 33486531 start codon destroyed probably benign 0.12
IGL02665:Serpinb9g APN 13 33495103 missense possibly damaging 0.54
IGL02936:Serpinb9g APN 13 33494882 missense possibly damaging 0.94
R1611:Serpinb9g UTSW 13 33492874 missense possibly damaging 0.46
R3873:Serpinb9g UTSW 13 33486535 missense probably benign 0.45
R4060:Serpinb9g UTSW 13 33495106 missense probably benign 0.19
R4505:Serpinb9g UTSW 13 33486563 missense probably damaging 1.00
R6399:Serpinb9g UTSW 13 33492851 missense probably benign
R6844:Serpinb9g UTSW 13 33486633 missense probably damaging 0.99
R6942:Serpinb9g UTSW 13 33494905 missense probably benign 0.03
R7319:Serpinb9g UTSW 13 33488560 nonsense probably null
R7466:Serpinb9g UTSW 13 33495167 missense probably benign
R7470:Serpinb9g UTSW 13 33486634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGATGTGGAAACCATCTG -3'
(R):5'- GATCCTAAAGACCTATGCCTGCC -3'

Sequencing Primer
(F):5'- GCTGATGTGGAAACCATCTGACTTC -3'
(R):5'- ATGCCTGCCTACAGCTTGAAG -3'
Posted On2018-09-12