Incidental Mutation 'R6843:Mapk13'
ID534643
Institutional Source Beutler Lab
Gene Symbol Mapk13
Ensembl Gene ENSMUSG00000004864
Gene Namemitogen-activated protein kinase 13
Synonymsp38 delta MAP kinase, SAPK4, Serk4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6843 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28769307-28778698 bp(+) (GRCm38)
Type of Mutationintron (91 bp from exon)
DNA Base Change (assembly) T to A at 28775453 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004986] [ENSMUST00000129096]
Predicted Effect probably null
Transcript: ENSMUST00000004986
SMART Domains Protein: ENSMUSP00000004986
Gene: ENSMUSG00000004864

DomainStartEndE-ValueType
S_TKc 25 308 8.72e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129096
SMART Domains Protein: ENSMUSP00000115659
Gene: ENSMUSG00000004864

DomainStartEndE-ValueType
Pfam:Pkinase 25 209 1.1e-49 PFAM
Pfam:Pkinase_Tyr 27 210 2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit improved glucose tolerance, increased insulin secretion, decreased blood glucose, and decreased susceptibility to diet- or chemically-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,401 Q78L probably benign Het
Akr1c21 A G 13: 4,575,214 H48R probably damaging Het
Anks1b T A 10: 90,948,598 S1143T probably damaging Het
Apip T G 2: 103,092,489 F217L probably benign Het
Ash1l T A 3: 88,985,388 Y1525N probably damaging Het
Bcl2l13 G A 6: 120,848,617 probably null Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Clk4 T G 11: 51,276,249 probably null Het
Cnr2 C T 4: 135,917,589 P326L probably benign Het
Cryaa A G 17: 31,678,173 D58G possibly damaging Het
Crybg3 G A 16: 59,559,796 T365M probably benign Het
Csmd2 A G 4: 128,463,794 N1683D probably benign Het
Dbx2 T G 15: 95,654,459 I102L possibly damaging Het
Dll4 A T 2: 119,325,994 probably benign Het
Epb42 T A 2: 121,027,685 Y264F possibly damaging Het
Exoc3l T A 8: 105,290,097 H695L probably benign Het
Fam160a1 G A 3: 85,673,045 P618S probably damaging Het
Ghsr A C 3: 27,372,527 D244A probably benign Het
Gm9195 A G 14: 72,441,211 Y2268H possibly damaging Het
Hdac1 A G 4: 129,542,590 Y14H probably damaging Het
Hdac3 A T 18: 37,941,954 Y282N probably benign Het
Heg1 T A 16: 33,719,526 N285K probably benign Het
Igkv4-90 A G 6: 68,807,686 F8S possibly damaging Het
Map2k1 A T 9: 64,187,691 D336E probably damaging Het
Map4k2 A T 19: 6,353,447 I796F probably damaging Het
Mprip A G 11: 59,759,728 I1419M possibly damaging Het
Nrap T C 19: 56,380,219 E255G probably damaging Het
Olfr1306 T C 2: 111,912,915 N5S probably damaging Het
Olfr1357 T C 10: 78,612,057 N195D probably damaging Het
Olfr1451 G T 19: 12,998,998 C4F probably benign Het
Olfr549 A G 7: 102,554,721 I146V probably benign Het
Olfr799 A G 10: 129,647,179 D17G possibly damaging Het
Oprl1 A G 2: 181,715,754 E11G probably damaging Het
Palmd T A 3: 116,924,215 D211V probably damaging Het
Pcdhga11 A G 18: 37,756,325 N129D probably damaging Het
Plekha6 T A 1: 133,274,878 M359K probably damaging Het
Plekha7 G T 7: 116,143,320 H756Q probably benign Het
Ppfibp2 C T 7: 107,727,731 P441S probably benign Het
Ptprk T C 10: 28,591,982 I1373T possibly damaging Het
Serpinb9g G T 13: 33,492,917 L227F probably damaging Het
Snapc4 C A 2: 26,373,599 A11S probably benign Het
Sqor T C 2: 122,784,980 V7A probably benign Het
Sqor G T 2: 122,809,295 G437V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
Stx1b G A 7: 127,814,979 Q72* probably null Het
Syt7 A G 19: 10,421,771 D77G probably damaging Het
Tvp23a G A 16: 10,447,020 A9V probably benign Het
Vmn1r66 T A 7: 10,274,765 I114F probably damaging Het
Vmn2r80 C A 10: 79,169,668 Q380K probably benign Het
Xdh C T 17: 73,923,130 E269K probably damaging Het
Zfp932 T C 5: 110,008,715 M92T probably benign Het
Other mutations in Mapk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Mapk13 APN 17 28776405 missense probably damaging 1.00
IGL01918:Mapk13 APN 17 28775330 missense probably damaging 1.00
IGL02265:Mapk13 APN 17 28777718 splice site probably benign
IGL02451:Mapk13 APN 17 28776413 missense probably damaging 1.00
IGL02977:Mapk13 APN 17 28776348 missense probably damaging 1.00
IGL03118:Mapk13 APN 17 28777735 missense probably benign 0.14
IGL03188:Mapk13 APN 17 28776583 intron probably benign
R0501:Mapk13 UTSW 17 28776353 missense probably damaging 1.00
R0538:Mapk13 UTSW 17 28775255 missense probably damaging 1.00
R2240:Mapk13 UTSW 17 28778111 missense probably damaging 0.98
R4368:Mapk13 UTSW 17 28777565 splice site probably null
R4613:Mapk13 UTSW 17 28769452 missense probably damaging 1.00
R4649:Mapk13 UTSW 17 28778487 nonsense probably null
R4684:Mapk13 UTSW 17 28770049 missense probably damaging 1.00
R4796:Mapk13 UTSW 17 28775554 missense probably damaging 1.00
R4863:Mapk13 UTSW 17 28776310 missense probably damaging 1.00
R4923:Mapk13 UTSW 17 28778223 missense probably benign
R5220:Mapk13 UTSW 17 28778491 missense probably benign 0.00
R5247:Mapk13 UTSW 17 28777751 missense probably benign 0.01
R5370:Mapk13 UTSW 17 28776352 nonsense probably null
R6838:Mapk13 UTSW 17 28777561 splice site probably null
R7187:Mapk13 UTSW 17 28776387 missense probably damaging 1.00
Z1088:Mapk13 UTSW 17 28777533 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGCCCTTCATGCAGACAGAC -3'
(R):5'- TGAGAACTGTCACTCCCAATCC -3'

Sequencing Primer
(F):5'- TGCAGACAGACCTACAGAAGATCATG -3'
(R):5'- TTGGCCACCAGAGTACCCTG -3'
Posted On2018-09-12