Incidental Mutation 'R6844:Pdcd1'
List |< first << previous [record 24 of 41] next >> last >|
ID534652
Institutional Source Beutler Lab
Gene Symbol Pdcd1
Ensembl Gene ENSMUSG00000026285
Gene Nameprogrammed cell death 1
SynonymsPD-1, Pdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location94038305-94052553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94039381 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 264 (R264H)
Ref Sequence ENSEMBL: ENSMUSP00000027507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027507]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION]
Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027507
AA Change: R264H

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027507
Gene: ENSMUSG00000026285
AA Change: R264H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 39 145 3.33e-9 SMART
transmembrane domain 170 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Pdcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pdcd1 APN 1 94040135 splice site probably benign
IGL01522:Pdcd1 APN 1 94040846 missense probably benign 0.00
IGL02337:Pdcd1 APN 1 94040857 missense probably benign 0.08
IGL02750:Pdcd1 APN 1 94039544 splice site probably benign
R6720_Pdcd1_520 UTSW 1 94041389 missense probably benign 0.00
R0092:Pdcd1 UTSW 1 94052424 missense possibly damaging 0.49
R0554:Pdcd1 UTSW 1 94039382 missense probably damaging 1.00
R0931:Pdcd1 UTSW 1 94039513 missense probably benign 0.05
R3932:Pdcd1 UTSW 1 94041264 missense probably benign 0.01
R5222:Pdcd1 UTSW 1 94052450 missense probably damaging 0.99
R5914:Pdcd1 UTSW 1 94040825 missense probably benign 0.15
R6186:Pdcd1 UTSW 1 94040121 nonsense probably null
R6720:Pdcd1 UTSW 1 94041389 missense probably benign 0.00
R8233:Pdcd1 UTSW 1 94039417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGTAGCCTGCATGC -3'
(R):5'- TTATGGGATGCACACACCAC -3'

Sequencing Primer
(F):5'- GCATGCTCCTCTTGACTGAG -3'
(R):5'- CAACTGACTATAACAATGGCTCTTTC -3'
Posted On2018-09-12