Incidental Mutation 'R6844:Mllt10'
List |< first << previous [record 19 of 41] next >> last >|
ID534654
Institutional Source Beutler Lab
Gene Symbol Mllt10
Ensembl Gene ENSMUSG00000026743
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
SynonymsAf10, D630001B22Rik, B130021D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location18055237-18212388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18159483 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 197 (I197V)
Ref Sequence ENSEMBL: ENSMUSP00000110319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028076] [ENSMUST00000114669] [ENSMUST00000114671] [ENSMUST00000114680]
Predicted Effect probably benign
Transcript: ENSMUST00000028076
AA Change: I275V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743
AA Change: I275V

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114669
SMART Domains Protein: ENSMUSP00000110317
Gene: ENSMUSG00000026743

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
coiled coil region 198 239 N/A INTRINSIC
low complexity region 293 336 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114671
AA Change: I197V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743
AA Change: I197V

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114680
AA Change: I275V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110328
Gene: ENSMUSG00000026743
AA Change: I275V

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Mllt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Mllt10 APN 2 18122317 missense probably damaging 1.00
IGL02366:Mllt10 APN 2 18065087 missense probably damaging 0.99
IGL02990:Mllt10 APN 2 18123711 splice site probably benign
IGL03034:Mllt10 APN 2 18065036 start codon destroyed probably null 0.55
R0348:Mllt10 UTSW 2 18162613 missense probably damaging 1.00
R0487:Mllt10 UTSW 2 18207137 missense probably damaging 0.98
R0492:Mllt10 UTSW 2 18146887 splice site probably benign
R0518:Mllt10 UTSW 2 18071206 critical splice donor site probably null
R0720:Mllt10 UTSW 2 18196595 missense probably benign
R0733:Mllt10 UTSW 2 18203766 intron probably benign
R1532:Mllt10 UTSW 2 18092835 critical splice donor site probably null
R1665:Mllt10 UTSW 2 18208790 missense possibly damaging 0.93
R1768:Mllt10 UTSW 2 18162846 missense probably damaging 1.00
R2098:Mllt10 UTSW 2 18162653 missense possibly damaging 0.50
R2114:Mllt10 UTSW 2 18162569 missense probably benign
R2116:Mllt10 UTSW 2 18162569 missense probably benign
R2117:Mllt10 UTSW 2 18162569 missense probably benign
R2179:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R2192:Mllt10 UTSW 2 18207060 missense probably benign 0.11
R2510:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R2511:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R4669:Mllt10 UTSW 2 18203633 missense probably damaging 1.00
R5004:Mllt10 UTSW 2 18170268 missense probably damaging 1.00
R5072:Mllt10 UTSW 2 18109874 missense possibly damaging 0.72
R5187:Mllt10 UTSW 2 18208774 nonsense probably null
R5561:Mllt10 UTSW 2 18109845 missense probably damaging 0.98
R6141:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R6352:Mllt10 UTSW 2 18123793 missense probably damaging 1.00
R7060:Mllt10 UTSW 2 18159560 missense possibly damaging 0.64
R7464:Mllt10 UTSW 2 18170279 missense probably benign
R7691:Mllt10 UTSW 2 18203611 missense possibly damaging 0.94
R7691:Mllt10 UTSW 2 18203612 missense probably null 0.94
R8079:Mllt10 UTSW 2 18123756 missense probably damaging 0.99
R8084:Mllt10 UTSW 2 18109826 missense probably damaging 0.99
Z1177:Mllt10 UTSW 2 18171076 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGAGATTGCAAAACAACC -3'
(R):5'- TGGATTTCTTCCTGCACCAG -3'

Sequencing Primer
(F):5'- CCCAAAAGGGTTGAAGTTGACTTC -3'
(R):5'- GCACCAGGCTTCCTTCC -3'
Posted On2018-09-12