Incidental Mutation 'R6844:Casq2'
List |< first << previous [record 3 of 41] next >> last >|
ID534662
Institutional Source Beutler Lab
Gene Symbol Casq2
Ensembl Gene ENSMUSG00000027861
Gene Namecalsequestrin 2
SynonymsESTM52, cCSQ, cardiac calsequestrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location102086415-102146514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102110262 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 86 (H86L)
Ref Sequence ENSEMBL: ENSMUSP00000131232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029454] [ENSMUST00000164123] [ENSMUST00000165540]
Predicted Effect probably benign
Transcript: ENSMUST00000029454
AA Change: H86L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029454
Gene: ENSMUSG00000027861
AA Change: H86L

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 382 1.4e-226 PFAM
Pfam:Thioredoxin_6 171 364 7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164123
AA Change: H86L

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131232
Gene: ENSMUSG00000027861
AA Change: H86L

DomainStartEndE-ValueType
Pfam:Calsequestrin 2 108 1.3e-46 PFAM
Pfam:Thioredoxin_6 101 293 6.1e-20 PFAM
Pfam:Calsequestrin 106 311 1.9e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165540
AA Change: H86L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130482
Gene: ENSMUSG00000027861
AA Change: H86L

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 386 7.4e-224 PFAM
Pfam:Thioredoxin_6 171 367 9.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause impaired intracellular calcium regulation in cardiac myocytes and lead to an arrhythmogenic syndrome called catecholaminergic polymorphic ventricular tachycardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Casq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Casq2 APN 3 102110231 splice site probably benign
IGL02597:Casq2 APN 3 102126637 missense probably damaging 1.00
IGL02863:Casq2 APN 3 102144175 missense possibly damaging 0.84
IGL02902:Casq2 APN 3 102086797 nonsense probably null
IGL03176:Casq2 APN 3 102126654 missense possibly damaging 0.50
R0126:Casq2 UTSW 3 102133399 missense probably damaging 1.00
R0653:Casq2 UTSW 3 102113166 critical splice donor site probably null
R1036:Casq2 UTSW 3 102142215 missense probably damaging 1.00
R1052:Casq2 UTSW 3 102144234 splice site probably null
R1158:Casq2 UTSW 3 102116883 missense probably damaging 1.00
R2886:Casq2 UTSW 3 102144218 missense probably damaging 1.00
R3001:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R3002:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R4155:Casq2 UTSW 3 102133102 splice site probably null
R4715:Casq2 UTSW 3 102110244 missense probably benign 0.00
R6013:Casq2 UTSW 3 102145629 unclassified probably null
R6778:Casq2 UTSW 3 102127931 splice site probably null
R6836:Casq2 UTSW 3 102086760 missense probably damaging 1.00
R7055:Casq2 UTSW 3 102142245 missense probably damaging 1.00
R7638:Casq2 UTSW 3 102086700 missense possibly damaging 0.73
R7761:Casq2 UTSW 3 102145264 missense probably damaging 1.00
R7997:Casq2 UTSW 3 102086842 missense probably damaging 0.98
R8169:Casq2 UTSW 3 102110312 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTCTCAAAGGCAGAAAGGGC -3'
(R):5'- CTCTACTCTGACCCAGAATGGTG -3'

Sequencing Primer
(F):5'- CCCATGGATGCGTTTTTCCAGG -3'
(R):5'- TTGAACTCCTGACCTTCGGAAGAG -3'
Posted On2018-09-12