Incidental Mutation 'R6844:Slc4a4'
List |< first << previous [record 33 of 41] next >> last >|
ID534666
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89228972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1028 (D1028E)
Ref Sequence ENSEMBL: ENSMUSP00000121744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113218
AA Change: D1019E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: D1019E

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130041
AA Change: D984E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: D984E

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148750
AA Change: D1028E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: D1028E

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156238
AA Change: D1028E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: D1028E

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
camera UTSW 5 89132507 missense probably damaging 1.00
pixels UTSW 5 89122403 missense probably damaging 0.99
Shutter UTSW 5 89225948 missense probably damaging 1.00
Tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
BB008:Slc4a4 UTSW 5 89170781 missense not run
BB018:Slc4a4 UTSW 5 89170781 missense not run
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0055:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6727:Slc4a4 UTSW 5 89170765 missense probably benign 0.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7180:Slc4a4 UTSW 5 89046236 missense probably damaging 0.97
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
R7412:Slc4a4 UTSW 5 89214647 synonymous probably null
R7492:Slc4a4 UTSW 5 89129650 missense possibly damaging 0.92
R7561:Slc4a4 UTSW 5 89199697 missense probably damaging 1.00
R7577:Slc4a4 UTSW 5 89225867 missense probably damaging 0.97
R7609:Slc4a4 UTSW 5 89135686 missense probably damaging 1.00
R7781:Slc4a4 UTSW 5 89228932 missense possibly damaging 0.78
R8078:Slc4a4 UTSW 5 89179707 missense probably benign 0.00
R8313:Slc4a4 UTSW 5 89046263 missense possibly damaging 0.84
Z1177:Slc4a4 UTSW 5 89132459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTGTCCTCTGATGTGCC -3'
(R):5'- AAGTGGTTACAGAAAGCCTTTG -3'

Sequencing Primer
(F):5'- GATGTGCCTGTCTTCTGATTGCC -3'
(R):5'- GTGGTTACAGAAAGCCTTTGAAAATG -3'
Posted On2018-09-12