Incidental Mutation 'R6844:Slc6a13'
List |< first << previous [record 34 of 41] next >> last >|
ID534668
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 13
SynonymsGat2, Gabt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121300227-121337733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121325053 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 198 (I198N)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
Predicted Effect probably damaging
Transcript: ENSMUST00000064580
AA Change: I198N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: I198N

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142419
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121321641 missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121325157 critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121335642 missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121333364 missense probably benign
IGL02988:Slc6a13 APN 6 121326107 unclassified probably benign
IGL03093:Slc6a13 APN 6 121332448 missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121334536 missense probably benign
IGL03384:Slc6a13 APN 6 121332391 missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121334876 missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121324320 missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121324303 missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121302867 missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121332374 missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121332369 missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121336926 missense probably benign
R1781:Slc6a13 UTSW 6 121334852 missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121332373 missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121325041 missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121336142 critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121325145 missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121325049 missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121333342 missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121336073 missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121302741 missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121321628 missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121302794 missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121334839 missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121336842 missense possibly damaging 0.83
R7379:Slc6a13 UTSW 6 121336839 nonsense probably null
R7734:Slc6a13 UTSW 6 121337375 missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121321699 missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121335630 missense probably damaging 1.00
R8177:Slc6a13 UTSW 6 121325028 nonsense probably null
RF020:Slc6a13 UTSW 6 121324351 critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121334503 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AACGTTCATAGCCCTGGGTTC -3'
(R):5'- CATTCAGGAAGGAAGCCACATG -3'

Sequencing Primer
(F):5'- CTGGGTTCTAACCCTTACAC -3'
(R):5'- TGCCTGGACCAGCCTAAAG -3'
Posted On2018-09-12