Incidental Mutation 'R6844:Omp'
List |< first << previous [record 23 of 41] next >> last >|
ID534671
Institutional Source Beutler Lab
Gene Symbol Omp
Ensembl Gene ENSMUSG00000074006
Gene Nameolfactory marker protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98143359-98145502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98145076 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 115 (M115L)
Ref Sequence ENSEMBL: ENSMUSP00000095882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000098281] [ENSMUST00000107112]
PDB Structure
CRYSTAL STRUCTURE OF MURINE OLFACTORY MARKER PROTEIN [X-RAY DIFFRACTION]
Crystal Structure of Murine Olfactory Marker Protein in Spacegroup P3121 [X-RAY DIFFRACTION]
Crystal Structure of Murine Olfactory Marker Protein in Spacegroup P43212 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040971
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098281
AA Change: M115L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095882
Gene: ENSMUSG00000074006
AA Change: M115L

DomainStartEndE-ValueType
Pfam:Olfactory_mark 11 161 7.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107112
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Olfactory marker protein is uniquely associated with the mature olfactory receptor neurons in many vertebrate species from fish to man. The OMP gene structure and protein sequence are highly conserved between mouse, rat and human. Results of the mouse knockout studies show that OMP-null mice are compromised in their ability to respond to odor stimuli, and that OMP represents a novel modulatory component of the odor detection/signal transduction cascade. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both copies of the coding sequence for this gene exhibit no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Omp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Omp APN 7 98145150 missense probably damaging 1.00
IGL01361:Omp APN 7 98145282 missense probably benign 0.04
R1589:Omp UTSW 7 98145359 missense probably benign 0.00
R2510:Omp UTSW 7 98145345 missense possibly damaging 0.64
R3722:Omp UTSW 7 98145213 missense probably benign 0.01
R4612:Omp UTSW 7 98145141 missense probably damaging 0.99
R4876:Omp UTSW 7 98145026 missense probably benign
R6662:Omp UTSW 7 98145339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCCCAAAATACACATGAGG -3'
(R):5'- TCGATTTCATCCAGCAGCAG -3'

Sequencing Primer
(F):5'- TCCCCAAAATACACATGAGGAAGGAG -3'
(R):5'- CAGAAGCTGCAGTTCGATCACTG -3'
Posted On2018-09-12