Incidental Mutation 'R6844:Mybpc1'
ID534677
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Namemyosin binding protein C, slow-type
Synonyms8030451F13Rik, Slow-type C-protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88518279-88605152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88536381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 796 (I796F)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
Predicted Effect probably benign
Transcript: ENSMUST00000119185
AA Change: I782F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: I782F

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121629
AA Change: I796F

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: I796F

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122472
Gene: ENSMUSG00000020061
AA Change: I34F

DomainStartEndE-ValueType
PDB:2YUW|A 2 52 2e-25 PDB
low complexity region 53 65 N/A INTRINSIC
IG 68 151 9.06e-2 SMART
FN3 154 236 2.06e-12 SMART
IGc2 281 348 1.88e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: I439F

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88549325 missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88548854 missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88542372 missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88558667 missense probably damaging 1.00
R7961:Mybpc1 UTSW 10 88537642 intron probably null
R8171:Mybpc1 UTSW 10 88523003 missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88558691 missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
Z1176:Mybpc1 UTSW 10 88560327 missense probably benign
Z1177:Mybpc1 UTSW 10 88573437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTTGGCCTTTGCTGGTAC -3'
(R):5'- AGACCCTGTTCTTTCCAAAGG -3'

Sequencing Primer
(F):5'- TTTGAGAGGGATCCACTAGCC -3'
(R):5'- ACCCTGTTCTTTCCAAAGGATCTAAG -3'
Posted On2018-09-12