Incidental Mutation 'R6844:Nr2c1'
List [record 1 of 41] next >> last >|
ID534678
Institutional Source Beutler Lab
Gene Symbol Nr2c1
Ensembl Gene ENSMUSG00000005897
Gene Namenuclear receptor subfamily 2, group C, member 1
Synonyms4831444H07Rik, Tr2-11, Eenr, TR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location94148023-94197211 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 94171167 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 289 (L289*)
Ref Sequence ENSEMBL: ENSMUSP00000100927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092213] [ENSMUST00000099343] [ENSMUST00000105290]
Predicted Effect probably null
Transcript: ENSMUST00000092213
AA Change: L289*
SMART Domains Protein: ENSMUSP00000089858
Gene: ENSMUSG00000005897
AA Change: L289*

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099343
AA Change: L289*
SMART Domains Protein: ENSMUSP00000096945
Gene: ENSMUSG00000005897
AA Change: L289*

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105290
AA Change: L289*
SMART Domains Protein: ENSMUSP00000100927
Gene: ENSMUSG00000005897
AA Change: L289*

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any defects in testis development or in spermatogenesis; no gross defects were detected in the central nervous system and normal motor neuron cell numbers were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Nr2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Nr2c1 APN 10 94190690 missense probably damaging 0.97
IGL02739:Nr2c1 APN 10 94156972 missense probably damaging 0.99
chillax UTSW 10 94163786 missense probably benign 0.38
R0077:Nr2c1 UTSW 10 94188255 missense probably benign 0.01
R0349:Nr2c1 UTSW 10 94195182 missense probably damaging 1.00
R0401:Nr2c1 UTSW 10 94171158 missense probably benign 0.02
R0418:Nr2c1 UTSW 10 94181512 missense probably benign 0.00
R0662:Nr2c1 UTSW 10 94190738 missense probably damaging 1.00
R1665:Nr2c1 UTSW 10 94188183 missense probably damaging 1.00
R1802:Nr2c1 UTSW 10 94163786 missense possibly damaging 0.95
R4812:Nr2c1 UTSW 10 94188252 missense probably benign 0.00
R5549:Nr2c1 UTSW 10 94167696 missense probably benign
R5928:Nr2c1 UTSW 10 94188193 missense probably damaging 1.00
R6219:Nr2c1 UTSW 10 94163786 missense probably benign 0.38
R6430:Nr2c1 UTSW 10 94195341 missense possibly damaging 0.77
R6431:Nr2c1 UTSW 10 94188216 missense probably damaging 1.00
R6745:Nr2c1 UTSW 10 94190664 missense probably damaging 1.00
R7707:Nr2c1 UTSW 10 94188165 missense probably benign 0.00
R7848:Nr2c1 UTSW 10 94190646 missense probably benign
R8257:Nr2c1 UTSW 10 94192907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAAGCATATCTGTCCCACCTTG -3'
(R):5'- AGAATGGAATGTGTTGGCCATG -3'

Sequencing Primer
(F):5'- GTCCCACCTTGCAAATTTTTAGTG -3'
(R):5'- AATGTGTTGGCCATGTTGTACTAAC -3'
Posted On2018-09-12