Incidental Mutation 'R6844:Gemin5'
List |< first << previous [record 12 of 41] next >> last >|
ID534679
Institutional Source Beutler Lab
Gene Symbol Gemin5
Ensembl Gene ENSMUSG00000037275
Gene Namegem nuclear organelle associated protein 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58120002-58168539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58163904 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 224 (D224G)
Ref Sequence ENSEMBL: ENSMUSP00000131842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]
Predicted Effect probably benign
Transcript: ENSMUST00000035604
AA Change: D224G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: D224G

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102711
AA Change: D224G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: D224G

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134953
SMART Domains Protein: ENSMUSP00000116600
Gene: ENSMUSG00000037275

DomainStartEndE-ValueType
Blast:WD40 2 29 7e-12 BLAST
WD40 33 82 1.99e0 SMART
WD40 85 125 5.15e-2 SMART
WD40 132 172 8.49e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172035
AA Change: D224G

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: D224G

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Gemin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Gemin5 APN 11 58163817 missense probably damaging 1.00
IGL00540:Gemin5 APN 11 58160818 missense probably damaging 1.00
IGL01521:Gemin5 APN 11 58134918 splice site probably benign
IGL02190:Gemin5 APN 11 58134842 missense probably damaging 1.00
IGL02274:Gemin5 APN 11 58156795 missense possibly damaging 0.80
IGL02494:Gemin5 APN 11 58121757 missense probably benign 0.12
IGL02549:Gemin5 APN 11 58134803 missense probably damaging 1.00
IGL02740:Gemin5 APN 11 58151564 missense probably damaging 1.00
IGL02815:Gemin5 APN 11 58146409 missense probably damaging 1.00
IGL02823:Gemin5 APN 11 58167705 splice site probably benign
IGL02939:Gemin5 APN 11 58156730 missense probably damaging 1.00
Landscape UTSW 11 58163904 missense probably benign 0.16
R0101:Gemin5 UTSW 11 58145496 missense probably damaging 1.00
R0479:Gemin5 UTSW 11 58139551 missense probably benign 0.00
R1481:Gemin5 UTSW 11 58141654 missense probably damaging 1.00
R1642:Gemin5 UTSW 11 58139080 missense probably damaging 1.00
R1648:Gemin5 UTSW 11 58147979 nonsense probably null
R1980:Gemin5 UTSW 11 58136917 missense probably damaging 1.00
R3079:Gemin5 UTSW 11 58145519 missense probably damaging 1.00
R3418:Gemin5 UTSW 11 58156628 intron probably null
R4260:Gemin5 UTSW 11 58168359 missense probably damaging 0.99
R4396:Gemin5 UTSW 11 58139549 missense probably benign 0.05
R4902:Gemin5 UTSW 11 58164277 missense probably benign 0.18
R5178:Gemin5 UTSW 11 58146518 missense probably benign 0.01
R5296:Gemin5 UTSW 11 58130061 missense probably damaging 1.00
R5350:Gemin5 UTSW 11 58141586 critical splice donor site probably null
R5426:Gemin5 UTSW 11 58125287 missense probably benign 0.00
R5494:Gemin5 UTSW 11 58130700 missense probably damaging 1.00
R5744:Gemin5 UTSW 11 58155183 missense possibly damaging 0.88
R5889:Gemin5 UTSW 11 58122355 missense possibly damaging 0.76
R5984:Gemin5 UTSW 11 58156761 missense probably damaging 1.00
R6934:Gemin5 UTSW 11 58147912 missense probably damaging 1.00
R6999:Gemin5 UTSW 11 58125121 missense probably benign 0.00
R7015:Gemin5 UTSW 11 58156740 missense probably damaging 1.00
R7144:Gemin5 UTSW 11 58141663 missense probably benign 0.30
R7176:Gemin5 UTSW 11 58166002 missense probably benign 0.05
R7540:Gemin5 UTSW 11 58130402 intron probably null
R7670:Gemin5 UTSW 11 58147928 missense probably benign 0.01
R7717:Gemin5 UTSW 11 58151530 critical splice donor site probably null
R7791:Gemin5 UTSW 11 58124993 missense probably benign 0.04
R8050:Gemin5 UTSW 11 58128860 missense probably benign 0.00
R8307:Gemin5 UTSW 11 58151594 missense probably damaging 1.00
X0066:Gemin5 UTSW 11 58151535 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACTTAGTCCCTCCAAGGTG -3'
(R):5'- TAACCACAGTGCATGTCCAGTG -3'

Sequencing Primer
(F):5'- ACTTAGTCCCTCCAAGGTGGGTAG -3'
(R):5'- AAAAATAAGCAGTTACTAGCTGCTC -3'
Posted On2018-09-12