Incidental Mutation 'R6844:Serpinb9g'
List [record 1 of 41] next >> last >|
ID534682
Institutional Source Beutler Lab
Gene Symbol Serpinb9g
Ensembl Gene ENSMUSG00000057726
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms1600002F03Rik, NK21B, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R6844 (G1)
Quality Score99.0078
Status Not validated
Chromosome13
Chromosomal Location33484790-33496004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33486633 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 35 (I35F)
Ref Sequence ENSEMBL: ENSMUSP00000080597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081927]
Predicted Effect probably damaging
Transcript: ENSMUST00000081927
AA Change: I35F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080597
Gene: ENSMUSG00000057726
AA Change: I35F

DomainStartEndE-ValueType
SERPIN 13 377 2.87e-166 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Serpinb9g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Serpinb9g APN 13 33495105 nonsense probably null
IGL02346:Serpinb9g APN 13 33486531 start codon destroyed probably benign 0.12
IGL02665:Serpinb9g APN 13 33495103 missense possibly damaging 0.54
IGL02936:Serpinb9g APN 13 33494882 missense possibly damaging 0.94
R1611:Serpinb9g UTSW 13 33492874 missense possibly damaging 0.46
R3873:Serpinb9g UTSW 13 33486535 missense probably benign 0.45
R4060:Serpinb9g UTSW 13 33495106 missense probably benign 0.19
R4505:Serpinb9g UTSW 13 33486563 missense probably damaging 1.00
R6399:Serpinb9g UTSW 13 33492851 missense probably benign
R6843:Serpinb9g UTSW 13 33492917 missense probably damaging 1.00
R6942:Serpinb9g UTSW 13 33494905 missense probably benign 0.03
R7319:Serpinb9g UTSW 13 33488560 nonsense probably null
R7466:Serpinb9g UTSW 13 33495167 missense probably benign
R7470:Serpinb9g UTSW 13 33486634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTCCGTATTTCCCTTCATCAG -3'
(R):5'- AGGCTCCATCAAATAGTATGTGG -3'

Sequencing Primer
(F):5'- CCGTATTTCCCTTCATCAGAAAAATG -3'
(R):5'- CAAGTAGCCTAGGGATTTTCCAGC -3'
Posted On2018-09-12