Incidental Mutation 'R6844:Ccdc188'
List |< first << previous [record 4 of 41] next >> last >|
ID534689
Institutional Source Beutler Lab
Gene Symbol Ccdc188
Ensembl Gene ENSMUSG00000090777
Gene Namecoiled-coil domain containing 188
SynonymsGm7873
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18217879-18220348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18218210 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 83 (G83E)
Ref Sequence ENSEMBL: ENSMUSP00000156029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076957] [ENSMUST00000167061] [ENSMUST00000231369] [ENSMUST00000231860] [ENSMUST00000231965]
Predicted Effect probably benign
Transcript: ENSMUST00000076957
SMART Domains Protein: ENSMUSP00000076224
Gene: ENSMUSG00000060166

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:zf-DHHC 99 224 4.8e-36 PFAM
low complexity region 304 318 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 551 563 N/A INTRINSIC
low complexity region 619 644 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167061
AA Change: G14E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132278
Gene: ENSMUSG00000090777
AA Change: G14E

DomainStartEndE-ValueType
low complexity region 13 36 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
coiled coil region 88 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231369
AA Change: G83E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000231412
Predicted Effect probably damaging
Transcript: ENSMUST00000231860
AA Change: G83E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000231965
AA Change: G83E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap18 G A 10: 26,772,686 A35T probably benign Het
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Ccdc188
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Ccdc188 UTSW 16 18219305 missense possibly damaging 0.83
R0594:Ccdc188 UTSW 16 18218920 missense probably benign 0.10
R1479:Ccdc188 UTSW 16 18219290 missense possibly damaging 0.92
R1757:Ccdc188 UTSW 16 18218688 missense probably damaging 1.00
R1986:Ccdc188 UTSW 16 18218843 missense probably damaging 0.96
R2327:Ccdc188 UTSW 16 18219206 missense probably damaging 1.00
R4404:Ccdc188 UTSW 16 18218420 missense probably damaging 0.98
R4690:Ccdc188 UTSW 16 18218295 missense probably damaging 1.00
R4914:Ccdc188 UTSW 16 18218219 missense probably benign 0.03
R5238:Ccdc188 UTSW 16 18219174 missense probably damaging 1.00
R7811:Ccdc188 UTSW 16 18218450 missense probably benign 0.30
R7832:Ccdc188 UTSW 16 18218675 missense probably damaging 1.00
R8066:Ccdc188 UTSW 16 18219194 missense probably damaging 1.00
R8101:Ccdc188 UTSW 16 18218012 missense probably benign 0.00
R8194:Ccdc188 UTSW 16 18218380 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAGGATACCTGGATCAGCC -3'
(R):5'- GATTGTTCTGCAGACCCCAG -3'

Sequencing Primer
(F):5'- ATACCTGGATCAGCCCTGTCAG -3'
(R):5'- CTAGATGAAGCTGTGGCCTTTCC -3'
Posted On2018-09-12