Incidental Mutation 'R6845:Foxs1'
ID534697
Institutional Source Beutler Lab
Gene Symbol Foxs1
Ensembl Gene ENSMUSG00000074676
Gene Nameforkhead box S1
SynonymsFkh3, FREAC10, Fkhl18
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152931898-152933208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152932699 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 145 (K145E)
Ref Sequence ENSEMBL: ENSMUSP00000096806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099200]
Predicted Effect probably benign
Transcript: ENSMUST00000099200
AA Change: K145E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096806
Gene: ENSMUSG00000074676
AA Change: K145E

DomainStartEndE-ValueType
FH 16 106 1.88e-60 SMART
low complexity region 269 283 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for one reporter allele display enhanced rotarod performance and increased male resistance to diet-induced obesity. Homozygotes for another reporter allele show impaired testicular vasculature, including blood accumulation in fetal testis and marked apoptosis of periendothelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Foxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Foxs1 APN 2 152932312 missense probably benign
IGL02304:Foxs1 APN 2 152932350 missense probably benign 0.01
IGL02491:Foxs1 APN 2 152932801 missense probably damaging 1.00
IGL03009:Foxs1 APN 2 152932929 missense probably damaging 1.00
IGL03046:Foxs1 UTSW 2 152932564 missense probably benign 0.00
R0158:Foxs1 UTSW 2 152932410 missense probably damaging 1.00
R0324:Foxs1 UTSW 2 152932687 missense probably benign 0.02
R1616:Foxs1 UTSW 2 152932639 missense probably benign 0.37
R1915:Foxs1 UTSW 2 152932840 missense probably damaging 0.99
R3113:Foxs1 UTSW 2 152932236 missense probably benign 0.00
R4885:Foxs1 UTSW 2 152932381 missense probably benign 0.00
R6084:Foxs1 UTSW 2 152932842 missense possibly damaging 0.81
R6265:Foxs1 UTSW 2 152932178 nonsense probably null
R6720:Foxs1 UTSW 2 152932720 missense probably damaging 0.99
R6828:Foxs1 UTSW 2 152933128 nonsense probably null
R7456:Foxs1 UTSW 2 152933125 missense probably benign
R7577:Foxs1 UTSW 2 152932441 missense probably benign 0.01
R7746:Foxs1 UTSW 2 152933108 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACTTTGCCGAGCACATCTC -3'
(R):5'- CCATAACCTGTCTCTCAACGAGTG -3'

Sequencing Primer
(F):5'- GAGCACATCTCTTTGGGTCCAG -3'
(R):5'- TCAAGGTGCCTCGTGATGAC -3'
Posted On2018-09-12