Incidental Mutation 'R6845:Ddx27'
ID534699
Institutional Source Beutler Lab
Gene Symbol Ddx27
Ensembl Gene ENSMUSG00000017999
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167015193-167034947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167022096 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 242 (C242R)
Ref Sequence ENSEMBL: ENSMUSP00000135815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000150571] [ENSMUST00000176066]
Predicted Effect probably damaging
Transcript: ENSMUST00000018143
AA Change: C214R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999
AA Change: C214R

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150571
AA Change: C214R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135265
Gene: ENSMUSG00000017999
AA Change: C214R

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
Pfam:DEAD 208 292 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176066
AA Change: C242R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135815
Gene: ENSMUSG00000017999
AA Change: C242R

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
low complexity region 171 198 N/A INTRINSIC
Pfam:DEAD 236 309 1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein involved in the processing of 5.8S and 28S ribosomal RNAs. More specifically, the encoded protein localizes to the nucleolus, where it interacts with the PeBoW complex to ensure proper 3' end formation of 47S rRNA. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Ddx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ddx27 APN 2 167019966 missense probably benign 0.00
IGL01610:Ddx27 APN 2 167022044 splice site probably benign
IGL01724:Ddx27 APN 2 167028389 missense probably damaging 1.00
IGL02035:Ddx27 APN 2 167029512 missense probably benign 0.00
IGL02141:Ddx27 APN 2 167020523 missense possibly damaging 0.67
IGL02402:Ddx27 APN 2 167015325 utr 5 prime probably benign
IGL02600:Ddx27 APN 2 167026204 missense probably damaging 1.00
IGL02882:Ddx27 APN 2 167027913 missense possibly damaging 0.86
IGL03177:Ddx27 APN 2 167027920 missense possibly damaging 0.76
R1938:Ddx27 UTSW 2 167034109 missense probably damaging 1.00
R2020:Ddx27 UTSW 2 167033771 missense probably damaging 1.00
R2038:Ddx27 UTSW 2 167033755 missense probably damaging 1.00
R2116:Ddx27 UTSW 2 167027764 missense probably benign 0.23
R3103:Ddx27 UTSW 2 167026246 missense probably damaging 1.00
R4524:Ddx27 UTSW 2 167027720 nonsense probably null
R4586:Ddx27 UTSW 2 167019984 missense probably benign 0.00
R4737:Ddx27 UTSW 2 167029299 missense probably benign 0.37
R5350:Ddx27 UTSW 2 167027860 unclassified probably benign
R5568:Ddx27 UTSW 2 167029519 missense possibly damaging 0.78
R5573:Ddx27 UTSW 2 167017886 missense possibly damaging 0.87
R5606:Ddx27 UTSW 2 167019966 missense probably benign 0.00
R6026:Ddx27 UTSW 2 167033640 missense probably benign 0.00
R6699:Ddx27 UTSW 2 167020503 missense possibly damaging 0.92
R6941:Ddx27 UTSW 2 167015377 missense possibly damaging 0.93
R7352:Ddx27 UTSW 2 167029513 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTGGTGCCTTAAGCTCTG -3'
(R):5'- TGAGATTAGAGGACAACACCAC -3'

Sequencing Primer
(F):5'- CTCTGGAGCAAAGGCACTCAG -3'
(R):5'- TTAAGAGAACGTGCTGCTCC -3'
Posted On2018-09-12