Incidental Mutation 'R6845:Gm5538'
ID534700
Institutional Source Beutler Lab
Gene Symbol Gm5538
Ensembl Gene ENSMUSG00000090527
Gene Namepredicted gene 5538
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location59729790-59752333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59752118 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 331 (P331T)
Ref Sequence ENSEMBL: ENSMUSP00000128877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168156]
Predicted Effect probably damaging
Transcript: ENSMUST00000168156
AA Change: P331T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128877
Gene: ENSMUSG00000090527
AA Change: P331T

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:DUF2424 70 214 9.3e-9 PFAM
Pfam:COesterase 91 236 5.4e-10 PFAM
Pfam:Abhydrolase_3 107 287 6.6e-36 PFAM
Pfam:Abhydrolase_3 271 375 1.4e-13 PFAM
Meta Mutation Damage Score 0.7413 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Gm5538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Gm5538 APN 3 59752121 missense possibly damaging 0.91
IGL00934:Gm5538 APN 3 59752053 missense probably benign 0.00
IGL02335:Gm5538 APN 3 59743605 missense probably benign
IGL02709:Gm5538 APN 3 59747198 missense probably damaging 1.00
IGL03114:Gm5538 APN 3 59743723 missense possibly damaging 0.55
R0107:Gm5538 UTSW 3 59752316 missense possibly damaging 0.78
R0591:Gm5538 UTSW 3 59752129 nonsense probably null
R0850:Gm5538 UTSW 3 59752248 missense possibly damaging 0.80
R1127:Gm5538 UTSW 3 59751893 missense probably benign 0.00
R1916:Gm5538 UTSW 3 59745503 missense possibly damaging 0.48
R3008:Gm5538 UTSW 3 59745509 missense possibly damaging 0.93
R3921:Gm5538 UTSW 3 59752077 missense probably damaging 0.98
R4368:Gm5538 UTSW 3 59751966 missense probably damaging 1.00
R5240:Gm5538 UTSW 3 59752028 missense probably damaging 0.99
R5268:Gm5538 UTSW 3 59752023 missense probably damaging 0.99
R5511:Gm5538 UTSW 3 59747264 missense probably damaging 1.00
R5564:Gm5538 UTSW 3 59752092 missense probably benign
R5812:Gm5538 UTSW 3 59747272 missense probably damaging 1.00
R5981:Gm5538 UTSW 3 59751878 missense probably benign
R6049:Gm5538 UTSW 3 59752149 missense probably damaging 1.00
R6195:Gm5538 UTSW 3 59752202 missense probably damaging 0.98
R6353:Gm5538 UTSW 3 59752108 missense probably damaging 1.00
R6449:Gm5538 UTSW 3 59745551 missense probably damaging 1.00
R7382:Gm5538 UTSW 3 59743616 missense probably benign 0.18
R7585:Gm5538 UTSW 3 59743722 missense possibly damaging 0.94
R7827:Gm5538 UTSW 3 59743691 missense probably damaging 0.99
R7844:Gm5538 UTSW 3 59729897 missense probably benign 0.32
R7927:Gm5538 UTSW 3 59729897 missense probably benign 0.32
Z1176:Gm5538 UTSW 3 59747194 missense not run
Predicted Primers PCR Primer
(F):5'- AGGATCAAGACACCTGTTCAAGTTTG -3'
(R):5'- ATGGCCTGGGAACTACCATG -3'

Sequencing Primer
(F):5'- CAAGTTTGTTAACTGGAGTGACTTCC -3'
(R):5'- AGCGAATACTTCACTTTATCAGTAAC -3'
Posted On2018-09-12