Incidental Mutation 'R6845:Gpr149'
ID534701
Institutional Source Beutler Lab
Gene Symbol Gpr149
Ensembl Gene ENSMUSG00000043441
Gene NameG protein-coupled receptor 149
SynonymsPGR10, R35, Ieda, 9630018L10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location62529077-62605140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62604521 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 19 (H19L)
Ref Sequence ENSEMBL: ENSMUSP00000060893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058535
AA Change: H19L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000060893
Gene: ENSMUSG00000043441
AA Change: H19L

DomainStartEndE-ValueType
Pfam:7tm_1 52 363 7.2e-7 PFAM
coiled coil region 694 730 N/A INTRINSIC
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit increased fertility with increased litter size and frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Gpr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Gpr149 APN 3 62530673 missense probably damaging 1.00
IGL01339:Gpr149 APN 3 62604297 missense probably damaging 1.00
IGL01399:Gpr149 APN 3 62604431 missense probably damaging 1.00
IGL01954:Gpr149 APN 3 62530927 missense probably benign 0.36
IGL02115:Gpr149 APN 3 62594915 missense probably benign 0.02
IGL02218:Gpr149 APN 3 62530531 utr 3 prime probably benign
IGL02592:Gpr149 APN 3 62603810 missense possibly damaging 0.75
IGL03393:Gpr149 APN 3 62603945 missense probably benign 0.15
R0578:Gpr149 UTSW 3 62602689 missense possibly damaging 0.81
R1173:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1174:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1175:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1432:Gpr149 UTSW 3 62531018 missense probably damaging 1.00
R1484:Gpr149 UTSW 3 62595171 missense probably benign 0.00
R1972:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R1973:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R2180:Gpr149 UTSW 3 62604068 missense probably damaging 1.00
R2241:Gpr149 UTSW 3 62604053 missense probably benign 0.00
R3118:Gpr149 UTSW 3 62595022 missense probably benign 0.00
R3547:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R3548:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R4206:Gpr149 UTSW 3 62604503 missense possibly damaging 0.92
R4332:Gpr149 UTSW 3 62604373 missense possibly damaging 0.93
R4531:Gpr149 UTSW 3 62602678 missense probably benign 0.00
R4557:Gpr149 UTSW 3 62530870 missense probably damaging 1.00
R4557:Gpr149 UTSW 3 62604497 missense probably benign 0.02
R4593:Gpr149 UTSW 3 62602730 intron probably benign
R5397:Gpr149 UTSW 3 62530805 missense probably damaging 1.00
R6592:Gpr149 UTSW 3 62530540 missense probably benign 0.02
R6642:Gpr149 UTSW 3 62530574 missense probably damaging 1.00
R7303:Gpr149 UTSW 3 62595070 missense possibly damaging 0.59
R7659:Gpr149 UTSW 3 62603835 missense probably benign 0.01
R7682:Gpr149 UTSW 3 62530739 missense probably damaging 1.00
R7803:Gpr149 UTSW 3 62530715 missense probably damaging 1.00
R7904:Gpr149 UTSW 3 62594935 missense probably benign 0.00
R7943:Gpr149 UTSW 3 62530711 missense probably damaging 1.00
Z1177:Gpr149 UTSW 3 62603959 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACCAAGATGTCACAAGTATGGAC -3'
(R):5'- CTGCCTGAAATGGAGCACAG -3'

Sequencing Primer
(F):5'- GGACAAAACAGTTCTGTATTGCATGG -3'
(R):5'- CTGAGACAGATCTTTCTACCGGAG -3'
Posted On2018-09-12