Incidental Mutation 'R6845:Mad1l1'
ID534708
Institutional Source Beutler Lab
Gene Symbol Mad1l1
Ensembl Gene ENSMUSG00000029554
Gene NameMAD1 mitotic arrest deficient 1-like 1
SynonymsMad1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location140008689-140321552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140009169 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 701 (A701S)
Ref Sequence ENSEMBL: ENSMUSP00000031534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]
Predicted Effect probably damaging
Transcript: ENSMUST00000031534
AA Change: A701S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: A701S

DomainStartEndE-ValueType
Pfam:MAD 54 715 1.6e-272 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110829
SMART Domains Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554

DomainStartEndE-ValueType
Pfam:MAD 2 511 2.5e-198 PFAM
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Mad1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Mad1l1 APN 5 140117277 missense probably benign 0.00
IGL02098:Mad1l1 APN 5 140310589 splice site probably benign
IGL02100:Mad1l1 APN 5 140143934 missense probably damaging 1.00
IGL03131:Mad1l1 APN 5 140307703 missense probably benign 0.18
R0738:Mad1l1 UTSW 5 140300560 missense probably damaging 1.00
R1902:Mad1l1 UTSW 5 140303688 missense possibly damaging 0.57
R1989:Mad1l1 UTSW 5 140303670 missense probably benign 0.27
R2090:Mad1l1 UTSW 5 140009256 missense probably benign 0.01
R2471:Mad1l1 UTSW 5 140261552 missense probably benign 0.43
R4049:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4050:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4096:Mad1l1 UTSW 5 140307673 missense probably benign 0.01
R4682:Mad1l1 UTSW 5 140300252 missense possibly damaging 0.47
R4729:Mad1l1 UTSW 5 140261511 missense possibly damaging 0.76
R4838:Mad1l1 UTSW 5 140300262 nonsense probably null
R5946:Mad1l1 UTSW 5 140261579 missense probably damaging 1.00
R6088:Mad1l1 UTSW 5 140193963 missense probably benign 0.13
R6362:Mad1l1 UTSW 5 140315055 missense possibly damaging 0.71
R6957:Mad1l1 UTSW 5 140065817 missense probably damaging 0.99
R6983:Mad1l1 UTSW 5 140193984 missense probably damaging 0.99
R7347:Mad1l1 UTSW 5 140144044 missense probably damaging 1.00
U24488:Mad1l1 UTSW 5 140315085 missense probably damaging 1.00
X0026:Mad1l1 UTSW 5 140009205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGATGCAGCTATGGGTG -3'
(R):5'- AGGCAACAAGCTTTCCACG -3'

Sequencing Primer
(F):5'- CTATGGGTGGCAAAGGGATCTG -3'
(R):5'- GACAGACACCTGTCCAATA -3'
Posted On2018-09-12