Incidental Mutation 'R6845:Slc22a21'
ID534724
Institutional Source Beutler Lab
Gene Symbol Slc22a21
Ensembl Gene ENSMUSG00000063652
Gene Namesolute carrier family 22 (organic cation transporter), member 21
SynonymsOctn3, Slc22a9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53949965-53980332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53979640 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 73 (D73G)
Ref Sequence ENSEMBL: ENSMUSP00000123180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586] [ENSMUST00000076493] [ENSMUST00000124221]
Predicted Effect probably benign
Transcript: ENSMUST00000020586
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076493
AA Change: D73G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075814
Gene: ENSMUSG00000063652
AA Change: D73G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 74 527 3.1e-31 PFAM
Pfam:MFS_1 139 376 3e-13 PFAM
low complexity region 528 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124221
AA Change: D73G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123180
Gene: ENSMUSG00000063652
AA Change: D73G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Slc22a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Slc22a21 APN 11 53979581 missense probably damaging 1.00
R0025:Slc22a21 UTSW 11 53979688 missense probably damaging 1.00
R0104:Slc22a21 UTSW 11 53951809 missense probably null 0.88
R0285:Slc22a21 UTSW 11 53959196 splice site probably benign
R0562:Slc22a21 UTSW 11 53979620 nonsense probably null
R0569:Slc22a21 UTSW 11 53951810 missense probably benign 0.00
R1237:Slc22a21 UTSW 11 53979772 missense probably benign 0.36
R2131:Slc22a21 UTSW 11 53979733 missense probably damaging 1.00
R2327:Slc22a21 UTSW 11 53951304 missense probably benign 0.25
R2991:Slc22a21 UTSW 11 53959369 missense probably damaging 1.00
R4209:Slc22a21 UTSW 11 53956055 missense probably benign 0.00
R4290:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4291:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4292:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4294:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4295:Slc22a21 UTSW 11 53969503 missense probably damaging 1.00
R4470:Slc22a21 UTSW 11 53956013 missense probably benign 0.00
R5194:Slc22a21 UTSW 11 53979847 missense probably damaging 1.00
R5214:Slc22a21 UTSW 11 53953043 missense probably damaging 0.99
R5698:Slc22a21 UTSW 11 53951349 missense probably benign 0.04
R6169:Slc22a21 UTSW 11 53958087 missense probably damaging 1.00
R6200:Slc22a21 UTSW 11 53958038 missense probably damaging 1.00
R6767:Slc22a21 UTSW 11 53979502 missense probably damaging 1.00
R7109:Slc22a21 UTSW 11 53979503 missense possibly damaging 0.88
R7402:Slc22a21 UTSW 11 53960400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGTCACGATGGTGGACAG -3'
(R):5'- GCCGACTCTATGCTTGACTAC -3'

Sequencing Primer
(F):5'- GGAAGATGTCCTTGTCGTACTCC -3'
(R):5'- GACTCTATGCTTGACTACGACGAG -3'
Posted On2018-09-12