Incidental Mutation 'R6845:Utp18'
ID534726
Institutional Source Beutler Lab
Gene Symbol Utp18
Ensembl Gene ENSMUSG00000054079
Gene NameUTP18 small subunit processome component
Synonyms6230425C22Rik, Wdr50
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6845 (G1)
Quality Score206.009
Status Validated
Chromosome11
Chromosomal Location93859243-93885766 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 93885756 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000066888] [ENSMUST00000107850] [ENSMUST00000107853] [ENSMUST00000107854]
Predicted Effect probably benign
Transcript: ENSMUST00000063645
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063718
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066888
SMART Domains Protein: ENSMUSP00000068103
Gene: ENSMUSG00000054079

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 100 111 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
WD40 236 275 7.4e0 SMART
WD40 280 320 3.08e0 SMART
Blast:WD40 325 365 4e-17 BLAST
WD40 368 406 2.23e-1 SMART
WD40 409 449 1.78e0 SMART
WD40 458 499 2.05e1 SMART
WD40 510 545 7.92e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107850
SMART Domains Protein: ENSMUSP00000103482
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Blast:MBT 25 52 2e-9 BLAST
PDB:2W0T|A 52 74 2e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
PDB:4C5I|B 131 201 5e-37 PDB
Blast:MBT 144 201 1e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107853
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107854
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Utp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Utp18 APN 11 93869848 missense possibly damaging 0.95
IGL02061:Utp18 APN 11 93882141 missense probably benign 0.05
IGL02402:Utp18 APN 11 93883791 unclassified probably benign
IGL02552:Utp18 APN 11 93868334 missense probably damaging 0.97
IGL03086:Utp18 APN 11 93876056 missense probably damaging 1.00
IGL03090:Utp18 APN 11 93868419 missense probably damaging 1.00
IGL03281:Utp18 APN 11 93875958 missense probably damaging 1.00
R0042:Utp18 UTSW 11 93875858 missense probably damaging 0.99
R0281:Utp18 UTSW 11 93882177 unclassified probably benign
R0399:Utp18 UTSW 11 93880147 splice site probably benign
R0543:Utp18 UTSW 11 93875835 missense probably damaging 1.00
R1512:Utp18 UTSW 11 93885564 missense probably benign 0.00
R1674:Utp18 UTSW 11 93876053 critical splice donor site probably null
R2013:Utp18 UTSW 11 93876122 missense possibly damaging 0.91
R4426:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4427:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4455:Utp18 UTSW 11 93885447 missense probably benign 0.09
R4458:Utp18 UTSW 11 93870533 missense possibly damaging 0.92
R5085:Utp18 UTSW 11 93870537 missense possibly damaging 0.78
R5297:Utp18 UTSW 11 93876089 missense probably damaging 0.99
R5321:Utp18 UTSW 11 93866434 missense probably damaging 1.00
R6006:Utp18 UTSW 11 93885623 missense probably benign 0.00
R7211:Utp18 UTSW 11 93885380 missense probably benign 0.01
R7330:Utp18 UTSW 11 93882073 critical splice donor site probably null
R8193:Utp18 UTSW 11 93876077 missense probably damaging 1.00
RF015:Utp18 UTSW 11 93885461 missense probably damaging 1.00
Z1177:Utp18 UTSW 11 93875821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTCCGTTGGGATGAAC -3'
(R):5'- GTTGCCTCCGAGAAGTTGTG -3'

Sequencing Primer
(F):5'- ATGAACGGGCGGCCTTTG -3'
(R):5'- CGAGAAGTTGTGTTGGGAAAAATTTC -3'
Posted On2018-09-12