Incidental Mutation 'R6845:Adam6a'
ID534729
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Namea disintegrin and metallopeptidase domain 6A
SynonymsAdam6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113543908-113546465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113544097 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 30 (L30P)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053086
AA Change: L30P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: L30P

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R7924:Adam6a UTSW 12 113545458 missense probably damaging 1.00
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense not run
Predicted Primers PCR Primer
(F):5'- ACCCAGTGACTGTTACCTAACTC -3'
(R):5'- ATGAGTGTCTTTCTCCGCAG -3'

Sequencing Primer
(F):5'- AGTGACTGTTACCTAACTCCAGTTG -3'
(R):5'- CGCAGGTGGATGATATGTCTC -3'
Posted On2018-09-12