Mutagenetix > Incidental Mutations

Incidental Mutation 'R6845:Tkfc'

534742

Institutional Source

Beutler Lab

Gene Symbol

Tkfc

Ensembl Gene

ENSMUSG00000034371

Gene Name

triokinase, FMN cyclase

Synonyms

Dak

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R6845 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10592200-10604258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10599332 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 94 (R94G)

Ref Sequence

ENSEMBL: ENSMUSP00000044556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037678]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037678
AA Change: R94G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371
AA Change: R94G

Domain	Start	End	E-Value	Type
Pfam:Dak1	19	335	1.9e-112	PFAM
low complexity region	352	366	N/A	INTRINSIC
Dak2	398	571	1.47e-58	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

95% (53/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,221,904	S1887P	possibly damaging	Het
Adam6a	T	C	12: 113,544,097	L30P	possibly damaging	Het
Cabin1	G	A	10: 75,721,508	R1099W	probably damaging	Het
Cdon	C	T	9: 35,486,956	Q990*	probably null	Het
Cit	T	A	5: 115,984,888	L1421Q	probably damaging	Het
Ddx27	T	C	2: 167,022,096	C242R	probably damaging	Het
Dlgap5	A	T	14: 47,416,563	V3E	possibly damaging	Het
Dnah6	A	T	6: 73,133,542	F1687I	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Duoxa1	A	T	2: 122,305,191	Y142*	probably null	Het
F3	A	G	3: 121,732,475	K229R	probably benign	Het
Fance	A	G	17: 28,317,591	R42G	probably damaging	Het
Foxs1	T	C	2: 152,932,699	K145E	probably benign	Het
Gm5538	C	A	3: 59,752,118	P331T	probably damaging	Het
Gpd1l	T	C	9: 114,933,717	M1V	probably null	Het
Gpr149	T	A	3: 62,604,521	H19L	possibly damaging	Het
Hmgcs1	T	C	13: 119,701,138	Y213H	probably damaging	Het
Htra1	C	A	7: 130,936,291		probably benign	Het
Il20ra	A	G	10: 19,759,311	I433M	probably benign	Het
Il3ra	G	C	14: 14,346,517		probably null	Het
Kif11	C	T	19: 37,404,117	L499F	probably damaging	Het
Kifc3	A	G	8: 95,108,679	M189T	probably benign	Het
Klk1b3	G	A	7: 44,201,703	A187T	probably benign	Het
Klre1	T	C	6: 129,584,239	S188P	probably damaging	Het
Krtap4-13	G	A	11: 99,809,366		probably benign	Het
Lgi4	A	T	7: 31,061,085	T22S	probably damaging	Het
Lrp10	C	T	14: 54,469,688	R661C	probably damaging	Het
Lrrtm1	A	G	6: 77,243,881	D107G	probably benign	Het
Mad1l1	C	A	5: 140,009,169	A701S	probably damaging	Het
Mia2	T	A	12: 59,184,278	Y1237*	probably null	Het
Mpp4	T	C	1: 59,144,804	D278G	probably benign	Het
Myh6	G	A	14: 54,944,749	S1734L	probably benign	Het
Nbeal1	C	T	1: 60,281,310	R2021*	probably null	Het
Nol4l	T	C	2: 153,416,662	T602A	probably benign	Het
Olfr1463	T	A	19: 13,234,633	C128S	probably damaging	Het
Pcdh15	A	T	10: 74,630,633	H894L	probably benign	Het
Phldb1	A	T	9: 44,716,062	I362N	probably damaging	Het
Plcxd2	T	A	16: 46,009,860		probably benign	Het
Ppp1r13l	G	T	7: 19,371,398	R365L	probably damaging	Het
Pramef25	T	C	4: 143,949,824	T237A	probably benign	Het
Rfc1	A	T	5: 65,311,116	S85T	possibly damaging	Het
Rnf133	A	G	6: 23,649,342	V196A	possibly damaging	Het
Shank3	T	C	15: 89,548,325	V1016A	probably benign	Het
Slc22a21	T	C	11: 53,979,640	D73G	probably benign	Het
Slc34a2	T	A	5: 53,069,169	F545I	probably damaging	Het
Slc4a7	T	A	14: 14,775,000	M810K	probably damaging	Het
Ss18	A	T	18: 14,655,164	M83K	possibly damaging	Het
Tpp2	T	A	1: 43,978,508	C757*	probably null	Het
Trav13n-4	T	C	14: 53,362,399	L11P	probably damaging	Het
Trpm4	T	C	7: 45,322,329	M138V	possibly damaging	Het
Utp18	G	A	11: 93,885,756		probably benign	Het
Vps33a	A	G	5: 123,535,272	V417A	probably benign	Het
Zfp207	C	T	11: 80,395,491		probably benign	Het

Other mutations in Tkfc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Tkfc	APN	19	10594528	missense	probably benign	0.28
IGL01149:Tkfc	APN	19	10600651	missense	probably damaging	1.00
IGL02726:Tkfc	APN	19	10596212	missense	possibly damaging	0.67
IGL03069:Tkfc	APN	19	10599154	missense	probably benign
R1367:Tkfc	UTSW	19	10593474	missense	probably benign	0.19
R1476:Tkfc	UTSW	19	10595326	missense	probably null	0.55
R2081:Tkfc	UTSW	19	10597378	missense	probably damaging	1.00
R2130:Tkfc	UTSW	19	10596041	missense	probably damaging	0.97
R2151:Tkfc	UTSW	19	10599057	missense	probably damaging	1.00
R2443:Tkfc	UTSW	19	10594538	missense	probably damaging	0.97
R3104:Tkfc	UTSW	19	10596993	nonsense	probably null
R3105:Tkfc	UTSW	19	10596993	nonsense	probably null
R3106:Tkfc	UTSW	19	10596993	nonsense	probably null
R5027:Tkfc	UTSW	19	10592659	splice site	probably null
R5601:Tkfc	UTSW	19	10594563	missense	probably benign
R5637:Tkfc	UTSW	19	10594533	missense	probably benign	0.00
R5933:Tkfc	UTSW	19	10597347	missense	probably benign	0.17
R6792:Tkfc	UTSW	19	10594524	missense	probably benign
R6909:Tkfc	UTSW	19	10596266	missense	probably benign	0.06
R7007:Tkfc	UTSW	19	10596363	missense	probably benign
R7883:Tkfc	UTSW	19	10595030	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGTTGAGCCGATCCCCAG -3'
(R):5'- TCTTTCAAGATGACTCCTGTGTAGG -3'

Sequencing Primer
(F):5'- CCCAGTGTAGTTCTTCACAATGAGG -3'
(R):5'- TGTAGGGGTTAGCCATAGCAC -3'

Posted On

2018-09-12