Incidental Mutation 'R6845:Tkfc'
ID534742
Institutional Source Beutler Lab
Gene Symbol Tkfc
Ensembl Gene ENSMUSG00000034371
Gene Nametriokinase, FMN cyclase
SynonymsDak
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10592200-10604258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10599332 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 94 (R94G)
Ref Sequence ENSEMBL: ENSMUSP00000044556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037678]
Predicted Effect probably damaging
Transcript: ENSMUST00000037678
AA Change: R94G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371
AA Change: R94G

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Rnf133 A G 6: 23,649,342 V196A possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Tkfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tkfc APN 19 10594528 missense probably benign 0.28
IGL01149:Tkfc APN 19 10600651 missense probably damaging 1.00
IGL02726:Tkfc APN 19 10596212 missense possibly damaging 0.67
IGL03069:Tkfc APN 19 10599154 missense probably benign
R1367:Tkfc UTSW 19 10593474 missense probably benign 0.19
R1476:Tkfc UTSW 19 10595326 missense probably null 0.55
R2081:Tkfc UTSW 19 10597378 missense probably damaging 1.00
R2130:Tkfc UTSW 19 10596041 missense probably damaging 0.97
R2151:Tkfc UTSW 19 10599057 missense probably damaging 1.00
R2443:Tkfc UTSW 19 10594538 missense probably damaging 0.97
R3104:Tkfc UTSW 19 10596993 nonsense probably null
R3105:Tkfc UTSW 19 10596993 nonsense probably null
R3106:Tkfc UTSW 19 10596993 nonsense probably null
R5027:Tkfc UTSW 19 10592659 unclassified probably null
R5601:Tkfc UTSW 19 10594563 missense probably benign
R5637:Tkfc UTSW 19 10594533 missense probably benign 0.00
R5933:Tkfc UTSW 19 10597347 missense probably benign 0.17
R6792:Tkfc UTSW 19 10594524 missense probably benign
R6909:Tkfc UTSW 19 10596266 missense probably benign 0.06
R7007:Tkfc UTSW 19 10596363 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTTGAGCCGATCCCCAG -3'
(R):5'- TCTTTCAAGATGACTCCTGTGTAGG -3'

Sequencing Primer
(F):5'- CCCAGTGTAGTTCTTCACAATGAGG -3'
(R):5'- TGTAGGGGTTAGCCATAGCAC -3'
Posted On2018-09-12