Incidental Mutation 'R6846:Dgkd'
ID534746
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R6846 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 87925691 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517]
Predicted Effect probably null
Transcript: ENSMUST00000027517
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ambn T A 5: 88,461,715 I94K possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Limd2 C T 11: 106,159,387 M1I probably null Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nfya A T 17: 48,395,687 M62K probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Pitpnm2 T C 5: 124,131,171 S463G probably benign Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vmn1r67 A T 7: 10,446,913 I35L probably benign Het
Vnn3 A G 10: 23,851,722 T47A probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R0591:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87941501 critical splice donor site probably null
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R4864:Dgkd UTSW 1 87916838 missense possibly damaging 0.94
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87936381 missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6905:Dgkd UTSW 1 87935375 missense probably damaging 1.00
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Z1176:Dgkd UTSW 1 87927810 missense probably benign 0.05
Z1177:Dgkd UTSW 1 87916886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACAGGTTGGTGACACTTTTG -3'
(R):5'- CTCGAGCCACAAAGTCCTTC -3'

Sequencing Primer
(F):5'- GACACTTTTGTCCTCGCTCC -3'
(R):5'- GAGCCACAAAGTCCTTCACTGTC -3'
Posted On2018-09-12