Incidental Mutation 'R6846:Ambn'
ID 534755
Institutional Source Beutler Lab
Gene Symbol Ambn
Ensembl Gene ENSMUSG00000029288
Gene Name ameloblastin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R6846 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 88455991-88468531 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88461715 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 94 (I94K)
Ref Sequence ENSEMBL: ENSMUSP00000031226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031226] [ENSMUST00000198265]
AlphaFold O55189
Predicted Effect possibly damaging
Transcript: ENSMUST00000031226
AA Change: I94K

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031226
Gene: ENSMUSG00000029288
AA Change: I94K

DomainStartEndE-ValueType
Amelin 11 407 7.19e-250 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198265
AA Change: I94K

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142944
Gene: ENSMUSG00000029288
AA Change: I94K

DomainStartEndE-ValueType
Amelin 11 422 8.22e-268 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes an extracellular matrix glycoprotein that is involved in the formation of dental enamel. Mice lacking the encoded protein fail to undergo normal ameloblast differentiation and develop enamel. Mice overproducing the product of this gene develop thinner and more porous enamel, with disrupted rod patterns and abnormal crystallites. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice lack enamel and display abnormal ameloblast and tooth morphology and an increased incidence of dental epithelium derived tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dgkd T G 1: 87,925,691 probably null Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Limd2 C T 11: 106,159,387 M1I probably null Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nfya A T 17: 48,395,687 M62K probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Pitpnm2 T C 5: 124,131,171 S463G probably benign Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vmn1r67 A T 7: 10,446,913 I35L probably benign Het
Vnn3 A G 10: 23,851,722 T47A probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Ambn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ambn APN 5 88459359 missense probably damaging 0.99
IGL01139:Ambn APN 5 88464517 splice site probably benign
IGL01318:Ambn APN 5 88460695 splice site probably benign
IGL02139:Ambn APN 5 88465290 missense probably benign
IGL02261:Ambn APN 5 88456948 missense probably damaging 1.00
IGL02743:Ambn APN 5 88464484 missense probably damaging 0.99
IGL03329:Ambn APN 5 88461668 missense probably benign 0.34
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0563:Ambn UTSW 5 88463450 missense probably benign 0.28
R1649:Ambn UTSW 5 88464481 missense probably benign 0.16
R2118:Ambn UTSW 5 88460758 splice site probably benign
R2121:Ambn UTSW 5 88460758 splice site probably benign
R2124:Ambn UTSW 5 88460758 splice site probably benign
R2495:Ambn UTSW 5 88467804 missense probably benign 0.05
R2877:Ambn UTSW 5 88460700 splice site probably benign
R3779:Ambn UTSW 5 88465342 splice site probably benign
R4760:Ambn UTSW 5 88467707 missense probably damaging 1.00
R5422:Ambn UTSW 5 88464511 critical splice donor site probably null
R5755:Ambn UTSW 5 88464491 splice site probably null
R5883:Ambn UTSW 5 88467829 nonsense probably null
R5970:Ambn UTSW 5 88467951 missense possibly damaging 0.88
R7166:Ambn UTSW 5 88467528 missense possibly damaging 0.94
R7500:Ambn UTSW 5 88461634 missense possibly damaging 0.95
R7809:Ambn UTSW 5 88467824 missense probably benign 0.00
R8306:Ambn UTSW 5 88459422 missense possibly damaging 0.95
R8898:Ambn UTSW 5 88465192 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATTGGCTTACCCATTCCAC -3'
(R):5'- GTAGGTCTCTTCTTTCAGAGGC -3'

Sequencing Primer
(F):5'- TCCACACAAACCTGAATTACTTTTGC -3'
(R):5'- ATTCCCTAAGTAACAGGAGTTATAGG -3'
Posted On 2018-09-12