Incidental Mutation 'R6846:Pitpnm2'
ID 534756
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Name phosphatidylinositol transfer protein, membrane-associated 2
Synonyms NIR3, RDGBA2, Rdgb2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6846 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124118690-124249760 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124131171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 463 (S463G)
Ref Sequence ENSEMBL: ENSMUSP00000124740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]
AlphaFold Q6ZPQ6
Predicted Effect probably benign
Transcript: ENSMUST00000086123
AA Change: S463G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: S463G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159677
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161273
AA Change: S463G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: S463G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161938
AA Change: S463G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: S463G

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162812
AA Change: S463G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: S463G

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ambn T A 5: 88,461,715 I94K possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dgkd T G 1: 87,925,691 probably null Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Limd2 C T 11: 106,159,387 M1I probably null Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nfya A T 17: 48,395,687 M62K probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vmn1r67 A T 7: 10,446,913 I35L probably benign Het
Vnn3 A G 10: 23,851,722 T47A probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
PIT4131001:Pitpnm2 UTSW 5 124131115 missense probably benign 0.01
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2008:Pitpnm2 UTSW 5 124152621 start codon destroyed probably damaging 0.99
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4407:Pitpnm2 UTSW 5 124152615 missense possibly damaging 0.57
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5151:Pitpnm2 UTSW 5 124136386 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5592:Pitpnm2 UTSW 5 124142149 missense probably damaging 1.00
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
R8041:Pitpnm2 UTSW 5 124121456 missense probably damaging 1.00
R9070:Pitpnm2 UTSW 5 124121312 missense probably damaging 1.00
R9218:Pitpnm2 UTSW 5 124127281 missense probably damaging 0.97
R9423:Pitpnm2 UTSW 5 124133406 missense probably benign 0.05
R9438:Pitpnm2 UTSW 5 124131279 missense probably damaging 0.99
R9439:Pitpnm2 UTSW 5 124136126 missense probably damaging 1.00
R9439:Pitpnm2 UTSW 5 124140596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAAAGGACCTGACACC -3'
(R):5'- GGCTACATCACTCCATCTCCAG -3'

Sequencing Primer
(F):5'- CGGGGAGCCATGCAATG -3'
(R):5'- AGGGGGACACCAATACTA -3'
Posted On 2018-09-12