Incidental Mutation 'R6846:Vmn1r67'
ID534759
Institutional Source Beutler Lab
Gene Symbol Vmn1r67
Ensembl Gene ENSMUSG00000046716
Gene Namevomeronasal 1 receptor 67
SynonymsV1re10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6846 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10443331-10449202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10446913 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 35 (I35L)
Ref Sequence ENSEMBL: ENSMUSP00000060746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055964] [ENSMUST00000226237]
Predicted Effect probably benign
Transcript: ENSMUST00000055964
AA Change: I35L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000060746
Gene: ENSMUSG00000046716
AA Change: I35L

DomainStartEndE-ValueType
Pfam:V1R 34 292 4.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226237
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ambn T A 5: 88,461,715 I94K possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dgkd T G 1: 87,925,691 probably null Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Limd2 C T 11: 106,159,387 M1I probably null Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nfya A T 17: 48,395,687 M62K probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Pitpnm2 T C 5: 124,131,171 S463G probably benign Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vnn3 A G 10: 23,851,722 T47A probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Vmn1r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Vmn1r67 APN 7 10446840 missense possibly damaging 0.96
IGL02812:Vmn1r67 APN 7 10447018 missense probably benign 0.01
IGL03121:Vmn1r67 APN 7 10447467 missense probably benign 0.00
IGL03208:Vmn1r67 APN 7 10447098 missense possibly damaging 0.94
PIT4142001:Vmn1r67 UTSW 7 10446950 missense probably benign 0.13
R0048:Vmn1r67 UTSW 7 10446866 missense probably damaging 1.00
R0549:Vmn1r67 UTSW 7 10447714 missense probably damaging 1.00
R1595:Vmn1r67 UTSW 7 10447670 missense probably benign 0.18
R1608:Vmn1r67 UTSW 7 10446980 missense possibly damaging 0.82
R2284:Vmn1r67 UTSW 7 10447673 missense probably damaging 0.97
R3614:Vmn1r67 UTSW 7 10447429 missense probably damaging 0.98
R4399:Vmn1r67 UTSW 7 10447549 missense possibly damaging 0.89
R4542:Vmn1r67 UTSW 7 10447430 missense probably damaging 0.99
R5216:Vmn1r67 UTSW 7 10447163 missense probably benign 0.00
R5655:Vmn1r67 UTSW 7 10447388 missense probably benign 0.43
R5837:Vmn1r67 UTSW 7 10447022 missense probably benign 0.26
R6526:Vmn1r67 UTSW 7 10447671 missense probably benign 0.05
R6735:Vmn1r67 UTSW 7 10447211 missense probably damaging 1.00
R7086:Vmn1r67 UTSW 7 10447117 missense possibly damaging 0.93
R7227:Vmn1r67 UTSW 7 10447548 nonsense probably null
R7594:Vmn1r67 UTSW 7 10447415 missense possibly damaging 0.95
R7608:Vmn1r67 UTSW 7 10447363 missense possibly damaging 0.89
R7797:Vmn1r67 UTSW 7 10446976 missense probably benign 0.30
R8681:Vmn1r67 UTSW 7 10447201 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATTCCTGAGCTTTAAGGACCCC -3'
(R):5'- CCGGCCAACACTTTGAATG -3'

Sequencing Primer
(F):5'- GAGCTTTAAGGACCCCTCTGATTTAG -3'
(R):5'- CAATGTGTGAGGCATTCC -3'
Posted On2018-09-12