Incidental Mutation 'R6846:Limd2'
ID534775
Institutional Source Beutler Lab
Gene Symbol Limd2
Ensembl Gene ENSMUSG00000040699
Gene NameLIM domain containing 2
Synonyms0610025L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6846 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106156256-106160860 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to T at 106159387 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000102488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002044] [ENSMUST00000007444] [ENSMUST00000045923] [ENSMUST00000064545] [ENSMUST00000100326] [ENSMUST00000103072] [ENSMUST00000106875]
Predicted Effect probably benign
Transcript: ENSMUST00000002044
SMART Domains Protein: ENSMUSP00000002044
Gene: ENSMUSG00000020700

DomainStartEndE-ValueType
PB1 44 123 1.04e-18 SMART
S_TKc 362 622 4.23e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007444
SMART Domains Protein: ENSMUSP00000007444
Gene: ENSMUSG00000069631

DomainStartEndE-ValueType
Pfam:Pkinase 69 379 2.4e-37 PFAM
Pfam:Pkinase_Tyr 70 302 2.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000045923
AA Change: M1I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045357
Gene: ENSMUSG00000040699
AA Change: M1I

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064545
AA Change: M1I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067070
Gene: ENSMUSG00000040699
AA Change: M1I

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100326
SMART Domains Protein: ENSMUSP00000097900
Gene: ENSMUSG00000075480

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103072
SMART Domains Protein: ENSMUSP00000099361
Gene: ENSMUSG00000069631

DomainStartEndE-ValueType
Pfam:Pkinase 32 342 2.2e-35 PFAM
Pfam:Pkinase_Tyr 33 266 2.5e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106875
AA Change: M1I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102488
Gene: ENSMUSG00000040699
AA Change: M1I

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Meta Mutation Damage Score 0.9557 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ambn T A 5: 88,461,715 I94K possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dgkd T G 1: 87,925,691 probably null Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nfya A T 17: 48,395,687 M62K probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Pitpnm2 T C 5: 124,131,171 S463G probably benign Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vmn1r67 A T 7: 10,446,913 I35L probably benign Het
Vnn3 A G 10: 23,851,722 T47A probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Limd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Limd2 APN 11 106159205 missense probably benign
IGL01516:Limd2 APN 11 106159044 missense probably benign
R2088:Limd2 UTSW 11 106158742 missense probably damaging 0.99
R4870:Limd2 UTSW 11 106159389 start codon destroyed probably null 0.36
R6807:Limd2 UTSW 11 106158945 missense probably benign
R6998:Limd2 UTSW 11 106158690 missense probably benign 0.11
R7877:Limd2 UTSW 11 106159178 missense probably benign 0.29
R7960:Limd2 UTSW 11 106159178 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TACCTTAGACCGCTGTACCG -3'
(R):5'- CCCAGAGCAACAGGAAATGACTTAG -3'

Sequencing Primer
(F):5'- TTAGACCGCTGTACCGTGCTG -3'
(R):5'- CAACAGGAAATGACTTAGGGAAAG -3'
Posted On2018-09-12