Mutagenetix > Incidental Mutation

Incidental Mutation 'R6847:Serpinb13'

534790

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R6847 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106998933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 220 (N220D)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000027564
AA Change: N220D

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: N220D

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136766

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	G	A	9: 51,290,204	T184M	probably damaging	Het
Adam26a	A	G	8: 43,568,428	I675T	probably benign	Het
Adgrb3	A	T	1: 25,093,922	M1121K	probably benign	Het
Ak9	A	G	10: 41,357,801		probably null	Het
Akr1c6	T	A	13: 4,438,498	C34*	probably null	Het
Akt3	G	A	1: 177,031,659	P449S	probably damaging	Het
Atg2b	A	T	12: 105,635,788	V1643E	probably damaging	Het
Atp2c1	T	C	9: 105,418,579	I819V	probably damaging	Het
Casp3	C	T	8: 46,636,266	A183V	probably benign	Het
Cdk1	A	T	10: 69,338,528	D288E	probably benign	Het
Cep131	G	A	11: 120,065,691	R944W	probably damaging	Het
Cep290	A	G	10: 100,563,419	K2268E	probably damaging	Het
Crybg2	A	G	4: 134,065,546	E164G	probably benign	Het
Cubn	A	C	2: 13,444,253		probably null	Het
Dnajc14	A	T	10: 128,816,787	E571D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eef1b2	A	G	1: 63,178,489	E44G	probably benign	Het
Eml6	C	T	11: 29,818,447	V747I	probably benign	Het
Ext1	T	G	15: 53,345,154	Q70H	probably benign	Het
Gbp2b	T	A	3: 142,598,179	C12S	probably damaging	Het
Gbp8	A	C	5: 105,031,227	D135E	probably benign	Het
Gm12886	A	T	4: 121,416,719	L100*	probably null	Het
Gpatch1	A	T	7: 35,293,558		probably null	Het
Ifit3b	A	T	19: 34,611,525	M34L	probably benign	Het
Il12a	G	T	3: 68,695,566	D160Y	probably damaging	Het
Klhl2	A	G	8: 64,759,782	L241P	probably damaging	Het
Krt80	T	C	15: 101,358,729	E195G	probably benign	Het
Lgi1	T	C	19: 38,301,290	V268A	probably damaging	Het
Lrrfip1	A	T	1: 91,105,128	D216V	probably damaging	Het
Meis3	A	G	7: 16,183,864	N314S	probably damaging	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	T	16: 49,145,088	I1119F	possibly damaging	Het
Nav2	A	T	7: 49,491,456	Q916H	probably benign	Het
Ncam2	A	T	16: 81,432,718	Q22L	probably damaging	Het
Olfr1474	A	T	19: 13,471,038	I23F	probably benign	Het
P2rx4	G	A	5: 122,727,751	V329M	probably damaging	Het
Peg10	A	G	6: 4,754,279		probably benign	Het
Pgp	T	C	17: 24,471,401	L267P	probably damaging	Het
Prdm2	A	C	4: 143,132,950	S1257A	probably benign	Het
Prr12	T	C	7: 45,045,740	N1434S	unknown	Het
Psmc3ip	A	T	11: 101,095,173	H40Q	probably damaging	Het
Ptprc	A	T	1: 138,088,545	N526K	probably damaging	Het
Sec63	T	A	10: 42,791,253	D138E	probably damaging	Het
Siva1	G	A	12: 112,644,910		probably benign	Het
Slc39a12	A	G	2: 14,449,917	H546R	probably damaging	Het
Slc7a1	G	A	5: 148,334,658	A497V	probably benign	Het
Smg5	G	T	3: 88,342,552	K95N	probably damaging	Het
Speer1	G	A	5: 11,344,167	V78M	probably damaging	Het
Traj50	T	A	14: 54,167,644		probably benign	Het
Ubr3	T	C	2: 69,983,128	V1261A	probably damaging	Het
Zc3h11a	A	T	1: 133,638,962		probably null	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
R9774:Serpinb13	UTSW	1	106995849	missense	probably benign	0.02
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTCTAATGTCATTTGGCCAAGTG -3'
(R):5'- GCGAGGCATCAAATGTTCAG -3'

Sequencing Primer
(F):5'- GGCCAAGTGATTATTCAGTTACTCAG -3'
(R):5'- CAAATGTTCAGAAGCCTTGTTCCCAG -3'

Posted On

2018-09-12