Incidental Mutation 'R6847:Zc3h11a'
ID534791
Institutional Source Beutler Lab
Gene Symbol Zc3h11a
Ensembl Gene ENSMUSG00000116275
Gene Name
Synonyms1110003F06Rik, 5730454B08Rik, G630041M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133619871-133661380 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 133638962 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195424]
Predicted Effect probably null
Transcript: ENSMUST00000027736
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179598
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186476
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000191896
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195669
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Other mutations in Zc3h11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zc3h11a APN 1 133625862 missense probably benign
IGL01961:Zc3h11a APN 1 133627067 missense probably benign 0.12
IGL02005:Zc3h11a APN 1 133622142 missense probably benign
IGL02365:Zc3h11a APN 1 133637413 missense probably benign 0.02
IGL02454:Zc3h11a APN 1 133624516 missense probably benign 0.09
PIT4449001:Zc3h11a UTSW 1 133624611 missense probably benign 0.22
R0180:Zc3h11a UTSW 1 133621611 missense probably benign 0.11
R0965:Zc3h11a UTSW 1 133645803 missense possibly damaging 0.80
R1389:Zc3h11a UTSW 1 133633803 missense probably damaging 0.99
R1607:Zc3h11a UTSW 1 133624687 missense probably benign
R1639:Zc3h11a UTSW 1 133624708 missense probably benign 0.03
R1720:Zc3h11a UTSW 1 133621701 missense probably damaging 0.97
R1728:Zc3h11a UTSW 1 133622154 missense probably benign
R1728:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1729:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1739:Zc3h11a UTSW 1 133622154 missense probably benign
R1739:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1762:Zc3h11a UTSW 1 133622154 missense probably benign
R1762:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1783:Zc3h11a UTSW 1 133622154 missense probably benign
R1783:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1784:Zc3h11a UTSW 1 133622154 missense probably benign
R1784:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1785:Zc3h11a UTSW 1 133622154 missense probably benign
R1785:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R2508:Zc3h11a UTSW 1 133624783 missense probably benign 0.01
R4792:Zc3h11a UTSW 1 133640698 missense probably damaging 0.98
R4901:Zc3h11a UTSW 1 133624711 missense probably benign 0.00
R4932:Zc3h11a UTSW 1 133624612 missense probably benign 0.00
R5135:Zc3h11a UTSW 1 133633789 missense probably benign 0.00
R5186:Zc3h11a UTSW 1 133621674 missense probably damaging 0.99
R5357:Zc3h11a UTSW 1 133623042 missense probably damaging 1.00
R5438:Zc3h11a UTSW 1 133640647 missense probably damaging 1.00
R6149:Zc3h11a UTSW 1 133638875 nonsense probably null
R6268:Zc3h11a UTSW 1 133624557 missense probably benign 0.01
R6385:Zc3h11a UTSW 1 133637454 missense possibly damaging 0.82
R7107:Zc3h11a UTSW 1 133638917 missense probably damaging 0.96
R7543:Zc3h11a UTSW 1 133627030 missense possibly damaging 0.49
R7693:Zc3h11a UTSW 1 133645737 missense probably damaging 1.00
R7742:Zc3h11a UTSW 1 133637435 missense probably benign 0.01
RF018:Zc3h11a UTSW 1 133627115 missense possibly damaging 0.66
RF020:Zc3h11a UTSW 1 133626997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGGATACTTCTAGGGCTGG -3'
(R):5'- AGCTCACAGTTCAACAGAGC -3'

Sequencing Primer
(F):5'- TACTTCTAGGGCTGGAAATCCGAC -3'
(R):5'- CAGAGCAAATTGTCTGTTCAGTC -3'
Posted On2018-09-12