Mutagenetix > Incidental Mutation

Incidental Mutation 'R6847:Ptprc'

534792

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6847 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 138088545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 526 (N526K)

Ref Sequence

ENSEMBL: ENSMUSP00000138275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]

AlphaFold

P06800

Predicted Effect

probably damaging
Transcript: ENSMUST00000182283
AA Change: N550K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: N550K

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182755
AA Change: N526K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: N526K

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183301
AA Change: N689K

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: N689K

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	G	A	9: 51,290,204	T184M	probably damaging	Het
Adam26a	A	G	8: 43,568,428	I675T	probably benign	Het
Adgrb3	A	T	1: 25,093,922	M1121K	probably benign	Het
Ak9	A	G	10: 41,357,801		probably null	Het
Akr1c6	T	A	13: 4,438,498	C34*	probably null	Het
Akt3	G	A	1: 177,031,659	P449S	probably damaging	Het
Atg2b	A	T	12: 105,635,788	V1643E	probably damaging	Het
Atp2c1	T	C	9: 105,418,579	I819V	probably damaging	Het
Casp3	C	T	8: 46,636,266	A183V	probably benign	Het
Cdk1	A	T	10: 69,338,528	D288E	probably benign	Het
Cep131	G	A	11: 120,065,691	R944W	probably damaging	Het
Cep290	A	G	10: 100,563,419	K2268E	probably damaging	Het
Crybg2	A	G	4: 134,065,546	E164G	probably benign	Het
Cubn	A	C	2: 13,444,253		probably null	Het
Dnajc14	A	T	10: 128,816,787	E571D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eef1b2	A	G	1: 63,178,489	E44G	probably benign	Het
Eml6	C	T	11: 29,818,447	V747I	probably benign	Het
Ext1	T	G	15: 53,345,154	Q70H	probably benign	Het
Gbp2b	T	A	3: 142,598,179	C12S	probably damaging	Het
Gbp8	A	C	5: 105,031,227	D135E	probably benign	Het
Gm12886	A	T	4: 121,416,719	L100*	probably null	Het
Gpatch1	A	T	7: 35,293,558		probably null	Het
Ifit3b	A	T	19: 34,611,525	M34L	probably benign	Het
Il12a	G	T	3: 68,695,566	D160Y	probably damaging	Het
Klhl2	A	G	8: 64,759,782	L241P	probably damaging	Het
Krt80	T	C	15: 101,358,729	E195G	probably benign	Het
Lgi1	T	C	19: 38,301,290	V268A	probably damaging	Het
Lrrfip1	A	T	1: 91,105,128	D216V	probably damaging	Het
Meis3	A	G	7: 16,183,864	N314S	probably damaging	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	T	16: 49,145,088	I1119F	possibly damaging	Het
Nav2	A	T	7: 49,491,456	Q916H	probably benign	Het
Ncam2	A	T	16: 81,432,718	Q22L	probably damaging	Het
Olfr1474	A	T	19: 13,471,038	I23F	probably benign	Het
P2rx4	G	A	5: 122,727,751	V329M	probably damaging	Het
Peg10	A	G	6: 4,754,279		probably benign	Het
Pgp	T	C	17: 24,471,401	L267P	probably damaging	Het
Prdm2	A	C	4: 143,132,950	S1257A	probably benign	Het
Prr12	T	C	7: 45,045,740	N1434S	unknown	Het
Psmc3ip	A	T	11: 101,095,173	H40Q	probably damaging	Het
Sec63	T	A	10: 42,791,253	D138E	probably damaging	Het
Serpinb13	A	G	1: 106,998,933	N220D	probably benign	Het
Siva1	G	A	12: 112,644,910		probably benign	Het
Slc39a12	A	G	2: 14,449,917	H546R	probably damaging	Het
Slc7a1	G	A	5: 148,334,658	A497V	probably benign	Het
Smg5	G	T	3: 88,342,552	K95N	probably damaging	Het
Speer1	G	A	5: 11,344,167	V78M	probably damaging	Het
Traj50	T	A	14: 54,167,644		probably benign	Het
Ubr3	T	C	2: 69,983,128	V1261A	probably damaging	Het
Zc3h11a	A	T	1: 133,638,962		probably null	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
Benighted	UTSW	1	138126301	critical splice donor site	probably null
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fluorescent	UTSW	1	138101192	missense	probably damaging	0.97
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
petechiae	UTSW	1	138113708	nonsense	probably null
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	splice site	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
R8677:Ptprc	UTSW	1	138083597	missense	probably damaging	1.00
R8704:Ptprc	UTSW	1	138115624	missense	probably benign	0.34
R8824:Ptprc	UTSW	1	138113708	nonsense	probably null
R8921:Ptprc	UTSW	1	138126301	critical splice donor site	probably null
R8998:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R8999:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R9154:Ptprc	UTSW	1	138088564	missense	probably damaging	1.00
R9388:Ptprc	UTSW	1	138083642	missense	possibly damaging	0.87
R9428:Ptprc	UTSW	1	138113747	missense	probably benign	0.01
R9467:Ptprc	UTSW	1	138066222	missense	probably damaging	1.00
R9468:Ptprc	UTSW	1	138117016	missense	probably benign	0.01
R9479:Ptprc	UTSW	1	138073650	missense	probably benign	0.38
R9526:Ptprc	UTSW	1	138068373	missense	probably benign	0.02
R9632:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9710:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9714:Ptprc	UTSW	1	138080949	missense	probably damaging	1.00
R9777:Ptprc	UTSW	1	138120163	missense
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTTACACCTAGCACCAGCAAG -3'
(R):5'- TTTCCCATCAAAGATGCCCG -3'

Sequencing Primer
(F):5'- CTTCGTAAACGTTAATGGATTTTGG -3'
(R):5'- TCAAAGATGCCCGAAAGCC -3'

Posted On

2018-09-12