Incidental Mutation 'R6847:Gm12886'
ID534800
Institutional Source Beutler Lab
Gene Symbol Gm12886
Ensembl Gene ENSMUSG00000078576
Gene Namepredicted gene 12886
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location121414735-121423099 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 121416719 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 100 (L100*)
Ref Sequence ENSEMBL: ENSMUSP00000101873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106266]
Predicted Effect probably null
Transcript: ENSMUST00000106266
AA Change: L100*
SMART Domains Protein: ENSMUSP00000101873
Gene: ENSMUSG00000078576
AA Change: L100*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Gm12886
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Gm12886 APN 4 121423032 missense unknown
IGL02948:Gm12886 APN 4 121423037 missense unknown
IGL03077:Gm12886 APN 4 121415500 utr 3 prime probably benign
R1793:Gm12886 UTSW 4 121422977 missense probably benign 0.22
R3722:Gm12886 UTSW 4 121417470 missense probably damaging 1.00
R4581:Gm12886 UTSW 4 121416683 missense probably damaging 0.98
R7169:Gm12886 UTSW 4 121416751 missense probably damaging 0.97
R7452:Gm12886 UTSW 4 121417474 nonsense probably null
Z1177:Gm12886 UTSW 4 121416719 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTGTTGCACGTACATG -3'
(R):5'- GTGGAAATACGATGGTCTCAAC -3'

Sequencing Primer
(F):5'- AATTCCACAATACTTACAGGAACATC -3'
(R):5'- TGTTGAGAAGGAAGTCCTG -3'
Posted On2018-09-12