Incidental Mutation 'R6847:Prdm2'
ID534802
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 143132950 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1257 (S1257A)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably benign
Transcript: ENSMUST00000105778
AA Change: S1257A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S1257A

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7968:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense not run
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTTTGTGCAGCGGATG -3'
(R):5'- TGCAATTTACAGCAGCATCAG -3'

Sequencing Primer
(F):5'- ATGGCAGTAGTGAAAGTCTGTG -3'
(R):5'- AGCGTGATCTCCACCCAGATG -3'
Posted On2018-09-12