Mutagenetix > Incidental Mutation

Incidental Mutation 'R6847:P2rx4'

534805

Institutional Source

Beutler Lab

Gene Symbol

P2rx4

Ensembl Gene

ENSMUSG00000029470

Gene Name

purinergic receptor P2X, ligand-gated ion channel 4

Synonyms

D5Ertd444e, P2X4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6847 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122707544-122729738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122727751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 329 (V329M)

Ref Sequence

ENSEMBL: ENSMUSP00000117193 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000081554] [ENSMUST00000111668] [ENSMUST00000139631] [ENSMUST00000142664] [ENSMUST00000198560]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031429
AA Change: V351M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470
AA Change: V351M

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	13	381	3e-175	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000081554
AA Change: V324M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080269
Gene: ENSMUSG00000029470
AA Change: V324M

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	13	176	1.6e-72	PFAM
Pfam:P2X_receptor	170	361	2.7e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111668

SMART Domains

Protein: ENSMUSP00000107297
Gene: ENSMUSG00000029471

Domain	Start	End	E-Value	Type
low complexity region	124	144	N/A	INTRINSIC
S_TKc	165	446	1.53e-92	SMART
low complexity region	464	472	N/A	INTRINSIC
low complexity region	526	539	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139631
AA Change: V302M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118163
Gene: ENSMUSG00000029470
AA Change: V302M

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	13	176	3.7e-73	PFAM
Pfam:P2X_receptor	171	301	4.6e-59	PFAM
Pfam:P2X_receptor	299	331	1.8e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000142664
AA Change: V329M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117193
Gene: ENSMUSG00000029470
AA Change: V329M

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	13	358	2.7e-151	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198560

SMART Domains

Protein: ENSMUSP00000142849
Gene: ENSMUSG00000029470

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	13	47	6.9e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in hypertension, abnormal artery morphology, abnormal nitric oxide homeostasis, and impaired flow induced vascular remodeling and vasodilation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	G	A	9: 51,290,204	T184M	probably damaging	Het
Adam26a	A	G	8: 43,568,428	I675T	probably benign	Het
Adgrb3	A	T	1: 25,093,922	M1121K	probably benign	Het
Ak9	A	G	10: 41,357,801		probably null	Het
Akr1c6	T	A	13: 4,438,498	C34*	probably null	Het
Akt3	G	A	1: 177,031,659	P449S	probably damaging	Het
Atg2b	A	T	12: 105,635,788	V1643E	probably damaging	Het
Atp2c1	T	C	9: 105,418,579	I819V	probably damaging	Het
Casp3	C	T	8: 46,636,266	A183V	probably benign	Het
Cdk1	A	T	10: 69,338,528	D288E	probably benign	Het
Cep131	G	A	11: 120,065,691	R944W	probably damaging	Het
Cep290	A	G	10: 100,563,419	K2268E	probably damaging	Het
Crybg2	A	G	4: 134,065,546	E164G	probably benign	Het
Cubn	A	C	2: 13,444,253		probably null	Het
Dnajc14	A	T	10: 128,816,787	E571D	possibly damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Eef1b2	A	G	1: 63,178,489	E44G	probably benign	Het
Eml6	C	T	11: 29,818,447	V747I	probably benign	Het
Ext1	T	G	15: 53,345,154	Q70H	probably benign	Het
Gbp2b	T	A	3: 142,598,179	C12S	probably damaging	Het
Gbp8	A	C	5: 105,031,227	D135E	probably benign	Het
Gm12886	A	T	4: 121,416,719	L100*	probably null	Het
Gpatch1	A	T	7: 35,293,558		probably null	Het
Ifit3b	A	T	19: 34,611,525	M34L	probably benign	Het
Il12a	G	T	3: 68,695,566	D160Y	probably damaging	Het
Klhl2	A	G	8: 64,759,782	L241P	probably damaging	Het
Krt80	T	C	15: 101,358,729	E195G	probably benign	Het
Lgi1	T	C	19: 38,301,290	V268A	probably damaging	Het
Lrrfip1	A	T	1: 91,105,128	D216V	probably damaging	Het
Meis3	A	G	7: 16,183,864	N314S	probably damaging	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	T	16: 49,145,088	I1119F	possibly damaging	Het
Nav2	A	T	7: 49,491,456	Q916H	probably benign	Het
Ncam2	A	T	16: 81,432,718	Q22L	probably damaging	Het
Olfr1474	A	T	19: 13,471,038	I23F	probably benign	Het
Peg10	A	G	6: 4,754,279		probably benign	Het
Pgp	T	C	17: 24,471,401	L267P	probably damaging	Het
Prdm2	A	C	4: 143,132,950	S1257A	probably benign	Het
Prr12	T	C	7: 45,045,740	N1434S	unknown	Het
Psmc3ip	A	T	11: 101,095,173	H40Q	probably damaging	Het
Ptprc	A	T	1: 138,088,545	N526K	probably damaging	Het
Sec63	T	A	10: 42,791,253	D138E	probably damaging	Het
Serpinb13	A	G	1: 106,998,933	N220D	probably benign	Het
Siva1	G	A	12: 112,644,910		probably benign	Het
Slc39a12	A	G	2: 14,449,917	H546R	probably damaging	Het
Slc7a1	G	A	5: 148,334,658	A497V	probably benign	Het
Smg5	G	T	3: 88,342,552	K95N	probably damaging	Het
Speer1	G	A	5: 11,344,167	V78M	probably damaging	Het
Traj50	T	A	14: 54,167,644		probably benign	Het
Ubr3	T	C	2: 69,983,128	V1261A	probably damaging	Het
Zc3h11a	A	T	1: 133,638,962		probably null	Het

Other mutations in P2rx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0709:P2rx4	UTSW	5	122714404	missense	probably damaging	1.00
R1081:P2rx4	UTSW	5	122727233	missense	probably damaging	0.98
R1464:P2rx4	UTSW	5	122714539	missense	probably damaging	0.97
R1464:P2rx4	UTSW	5	122714539	missense	probably damaging	0.97
R3434:P2rx4	UTSW	5	122725070	missense	probably damaging	1.00
R3435:P2rx4	UTSW	5	122725070	missense	probably damaging	1.00
R5090:P2rx4	UTSW	5	122725055	missense	probably damaging	1.00
R5318:P2rx4	UTSW	5	122719148	missense	probably null	1.00
R5888:P2rx4	UTSW	5	122719165	missense	probably benign
R5888:P2rx4	UTSW	5	122727208	missense	probably damaging	1.00
R5994:P2rx4	UTSW	5	122725079	missense	probably damaging	1.00
R6450:P2rx4	UTSW	5	122727241	missense	possibly damaging	0.88
R6478:P2rx4	UTSW	5	122707700	missense	probably damaging	0.99
X0064:P2rx4	UTSW	5	122707779	nonsense	probably null
X0066:P2rx4	UTSW	5	122707745	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCTAGACTGGATGCCGTTTG -3'
(R):5'- GTAACTGCTGGGGTGATCAG -3'

Sequencing Primer
(F):5'- TTTGGGGTGAGGAGAAAGATTCCC -3'
(R):5'- CTCGGTAGAAGGGCCTTTGCTC -3'

Posted On

2018-09-12