Incidental Mutation 'R6847:Meis3'
ID534808
Institutional Source Beutler Lab
Gene Symbol Meis3
Ensembl Gene ENSMUSG00000041420
Gene NameMeis homeobox 3
SynonymsMrg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16175090-16186504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16183864 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 314 (N314S)
Ref Sequence ENSEMBL: ENSMUSP00000002495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002495] [ENSMUST00000176446] [ENSMUST00000176506] [ENSMUST00000177156]
Predicted Effect probably damaging
Transcript: ENSMUST00000002495
AA Change: N314S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002495
Gene: ENSMUSG00000041420
AA Change: N314S

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
HOX 265 330 9.15e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176446
Predicted Effect probably damaging
Transcript: ENSMUST00000176506
AA Change: N297S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134918
Gene: ENSMUSG00000041420
AA Change: N297S

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
HOX 248 313 9.15e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177156
SMART Domains Protein: ENSMUSP00000135103
Gene: ENSMUSG00000041420

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Pfam:Homeobox_KN 283 313 2e-12 PFAM
Meta Mutation Damage Score 0.8552 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: The protein encoding this gene belongs to the three amino acid loop extension family of homeodomain transcription factors, which play essential roles in many embryonic processes. These proteins are characterized by an atypical homeodomain containing a three amino acid loop extension between helices 1 and 2. Expression of this gene begins during the compaction stage of embryogenesis and continues into the blastocyst stage. This gene is also expressed in pancreatic islet cells and beta-cells and regulates beta-cell survival. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Meis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Meis3 APN 7 16178947 critical splice acceptor site probably benign 0.00
IGL02508:Meis3 APN 7 16178797 unclassified probably null
IGL03125:Meis3 APN 7 16178770 missense probably damaging 1.00
IGL03383:Meis3 APN 7 16183819 missense probably damaging 1.00
R0032:Meis3 UTSW 7 16182285 unclassified probably benign
R1147:Meis3 UTSW 7 16183776 unclassified probably benign
R1471:Meis3 UTSW 7 16177571 nonsense probably null
R3054:Meis3 UTSW 7 16182453 missense probably damaging 1.00
R3927:Meis3 UTSW 7 16177494 missense probably benign 0.06
R5314:Meis3 UTSW 7 16184064 missense probably damaging 0.99
R6713:Meis3 UTSW 7 16182330 nonsense probably null
R7218:Meis3 UTSW 7 16184701 missense probably benign
R7517:Meis3 UTSW 7 16177818 missense probably damaging 1.00
R7540:Meis3 UTSW 7 16177493 nonsense probably null
R7699:Meis3 UTSW 7 16177556 missense probably benign
R7700:Meis3 UTSW 7 16177556 missense probably benign
R7790:Meis3 UTSW 7 16182397 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CAAGGCTTTGTTGAGCTCCAC -3'
(R):5'- CCGGGCATTAATAAACCTGGG -3'

Sequencing Primer
(F):5'- GTTGAGCTCCACCCCTTTGG -3'
(R):5'- GCATTAATAAACCTGGGAAGTGATG -3'
Posted On2018-09-12