Incidental Mutation 'R6847:Dnajc14'
ID534821
Institutional Source Beutler Lab
Gene Symbol Dnajc14
Ensembl Gene ENSMUSG00000025354
Gene NameDnaJ heat shock protein family (Hsp40) member C14
SynonymsDRIP78, LIP6, HDJ3, 5730551F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128804062-128819446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128816787 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 571 (E571D)
Ref Sequence ENSEMBL: ENSMUSP00000151343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026409] [ENSMUST00000026410] [ENSMUST00000217685] [ENSMUST00000217745] [ENSMUST00000219215] [ENSMUST00000219508] [ENSMUST00000219524]
Predicted Effect probably benign
Transcript: ENSMUST00000026409
SMART Domains Protein: ENSMUSP00000026409
Gene: ENSMUSG00000025353

DomainStartEndE-ValueType
Pfam:ORMDL 11 146 4.4e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000026410
AA Change: E571D

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354
AA Change: E571D

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217685
Predicted Effect possibly damaging
Transcript: ENSMUST00000217745
AA Change: E571D

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219215
Predicted Effect possibly damaging
Transcript: ENSMUST00000219508
AA Change: E571D

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Dnajc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Dnajc14 APN 10 128806332 missense probably damaging 1.00
IGL00924:Dnajc14 APN 10 128817319 missense probably benign
IGL00943:Dnajc14 APN 10 128816806 missense possibly damaging 0.92
IGL02833:Dnajc14 APN 10 128806599 missense possibly damaging 0.94
IGL02799:Dnajc14 UTSW 10 128806856 missense possibly damaging 0.88
PIT4812001:Dnajc14 UTSW 10 128806683 missense probably damaging 0.96
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R1932:Dnajc14 UTSW 10 128816792 missense probably damaging 1.00
R4412:Dnajc14 UTSW 10 128806205 start gained probably benign
R4717:Dnajc14 UTSW 10 128806244 missense possibly damaging 0.92
R4804:Dnajc14 UTSW 10 128814057 missense probably benign 0.06
R4870:Dnajc14 UTSW 10 128817350 missense probably benign 0.00
R6323:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6325:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6399:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6400:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6452:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6453:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6556:Dnajc14 UTSW 10 128814631 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CTAGAGAGGCAGGTATTACAGC -3'
(R):5'- AACTCTGTGAGTATCTGGGGAG -3'

Sequencing Primer
(F):5'- GTTGCAGGAGGTTTGAAAT -3'
(R):5'- GGAGATACCCACACGCTG -3'
Posted On2018-09-12